View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_low_38 (Length: 252)
Name: NF20174_low_38
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_low_38 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (3 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 48)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 35005202 - 35005284
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
35005202 |
ctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 18742038 - 18741955
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||| ||||||||||| |||||||| |
|
|
| T |
18742038 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttt |
18741955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 166 - 243
Target Start/End: Original strand, 50606487 - 50606564
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
50606564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 20004171 - 20004089
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
20004171 |
ctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 158 - 243
Target Start/End: Original strand, 45402174 - 45402257
Alignment:
| Q |
158 |
tctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||||||||||||||||| | |||||| ||||||||||||||| ||||| |
|
|
| T |
45402174 |
tctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccgttttt |
45402257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 10668309 - 10668386
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| | ||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
10668309 |
tacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 18944722 - 18944807
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | || |||| ||||||||||||||||||||| |
|
|
| T |
18944722 |
ctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttttt |
18944807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 244
Target Start/End: Original strand, 27201726 - 27201811
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||| |||||||||| | |||||| |||| |||||||||||||||| |
|
|
| T |
27201726 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctttttta |
27201811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 4349717 - 4349796
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
4349717 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 242
Target Start/End: Complemental strand, 42304283 - 42304205
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||||||||||||| | | |||||| |||||||| ||||||||||| |
|
|
| T |
42304283 |
tacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 244
Target Start/End: Complemental strand, 46248032 - 46247949
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| || ||||||||||||||||||| |
|
|
| T |
46248032 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttttta |
46247949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 43768239 - 43768300
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| || | |||||||||||||||| ||||||||||| |
|
|
| T |
43768239 |
gtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctttttt |
43768300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 30395807 - 30395725
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
30395807 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 1517369 - 1517308
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||| |||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
1517369 |
gtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttttt |
1517308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 45812616 - 45812534
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| ||||||| |||||| | ||| || |||||||||||||| |||||| |
|
|
| T |
45812616 |
ctgcatacaatacaccaaa--tggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttttt |
45812534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 241
Target Start/End: Original strand, 9939547 - 9939623
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggacccc-ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||| |||||||||| ||| | ||||||||||||||| | |||||| ||||||||||| ||||||| |
|
|
| T |
9939547 |
caatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctttt |
9939623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 19932834 - 19932782
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
211 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
19932834 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgc |
19932782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 4447794 - 4447849
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
4447794 |
tggcccatttctatagtcgggcctcttaggcccgagccggcccatttgacacctct |
4447849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 27474380 - 27474439
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||||| |||||||||| |
|
|
| T |
27474380 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 244
Target Start/End: Original strand, 46991904 - 46991966
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||||||| ||||||||||||| | | |||||| ||||||||||||||| |||||| |
|
|
| T |
46991904 |
gtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgcccattttta |
46991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 31382293 - 31382211
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |||||||| |||||| | |||||| || |||||||||||||||||| |
|
|
| T |
31382293 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctttttt |
31382211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 35019309 - 35019390
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||||||||||| | |||||| ||||||||| |||| |||||| |
|
|
| T |
35019309 |
ctgcatacaatacaccaat--tggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgggctgccatttttt |
35019390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 23796549 - 23796626
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||||| ||||| | |||||| ||||||||| ||||||||||| |
|
|
| T |
23796549 |
tacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgccctttttt |
23796626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 34725161 - 34725097
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
34725161 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 35253266 - 35253185
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||| ||||||||||| |
|
|
| T |
35253266 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
35253185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 19414516 - 19414596
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
19414516 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 19701654 - 19701732
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||| ||||||||||||||| | |||||| |||||| || | ||||||||| |
|
|
| T |
19701654 |
tacaatacaccaaaa-tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctaccctttttt |
19701732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 22324971 - 22325049
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||| ||||||||||||||| | |||||| |||||| || |||||| |
|
|
| T |
22324971 |
ctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcgggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 33594189 - 33594130
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||| ||| | ||||||| |
|
|
| T |
33594189 |
gtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt |
33594130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 14617122 - 14617197
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| | |||||| |||||||| |||||||| |||||| | |||||| ||||||||||| ||||||| |
|
|
| T |
14617122 |
tacaatacaccaaa--tggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttt |
14617197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 30555210 - 30555276
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||| | |||||| ||||||||| || |||||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgacctttttt |
30555276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 244
Target Start/End: Complemental strand, 38478361 - 38478278
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| |||||||||||||| | |||| |||||||| | |||||||| |||||| | ||| || |||||||||||||||||||||| |
|
|
| T |
38478361 |
ctgcgtacaatacaccaaa--tggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctttttta |
38478278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 6925200 - 6925261
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| | ||||||||||||| | |||||| ||||||| |||||| |||||| |
|
|
| T |
6925200 |
gtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttttt |
6925261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 23768399 - 23768325
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgc |
235 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||||||||||||||||||| | |||||| |||| ||| |||| |
|
|
| T |
23768399 |
ctgcgtacaatacaccaaa--tggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 35117842 - 35117765
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgt-atgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| |||| | |||||| ||||||||| | |||||| |
|
|
| T |
35117842 |
tacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 160
Target Start/End: Complemental strand, 48814166 - 48814129
Alignment:
| Q |
123 |
gggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48814166 |
gggcctcgcgggcccgggccggcccatttgacacctct |
48814129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 6358200 - 6358251
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
211 |
Q |
| |
|
|||| ||||| ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
6358200 |
ctgcgtacaaaacaccaaaa-tggtgggaccccttcccagaccctgcgtatgc |
6358251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 47214593 - 47214670
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||| |||||| | ||| || |||||| | || ||||||||| |
|
|
| T |
47214593 |
tacaatacaccaaa--tggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattaccctttttt |
47214670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 12126916 - 12126836
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||| | ||||||||||| |
|
|
| T |
12126916 |
ctgcgtacaatacaccaaa--ttgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 238
Target Start/End: Complemental strand, 15511224 - 15511150
Alignment:
| Q |
163 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||| ||||||||||||| | | |||||| ||||||||| |||||| |
|
|
| T |
15511224 |
atacaatacaccaaaa-tggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 32632636 - 32632556
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||| ||||||| |||||| | |||| | |||||| |||| ||||||| |
|
|
| T |
32632636 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctttt |
32632556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 199 - 242
Target Start/End: Complemental strand, 50760281 - 50760238
Alignment:
| Q |
199 |
accctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
50760281 |
accctgcgtatgcgggagctttaatgcaccgggctgcccttttt |
50760238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 235
Target Start/End: Complemental strand, 4587626 - 4587568
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgc |
235 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | |||| | ||||||||||||| |
|
|
| T |
4587626 |
aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 228
Target Start/End: Complemental strand, 45264472 - 45264411
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcacc |
228 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||| |||||| | |||||| |||||| |
|
|
| T |
45264472 |
caatacaccaaaa-tggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 50812024 - 50812100
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||||| | |||| |||||||||| ||||||||||||| | |||||||||||| ||| |||||||||| |
|
|
| T |
50812024 |
tacaatacaccaaaa-tggtgg-accccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 185 - 242
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
| Q |
185 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||||| | |||||| |||||| | ||||||||||||| || |||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt |
16120876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 160
Target Start/End: Complemental strand, 20270630 - 20270593
Alignment:
| Q |
123 |
gggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20270630 |
gggcctctcgggctcgggccagcccatttgacacctct |
20270593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5153726 - 5153667
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5153726 |
tggcccatttc-atagtcgggcctctcgggcttgggccgggccggcccatttgacacctct |
5153667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 29)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 156 - 241
Target Start/End: Original strand, 12885964 - 12886049
Alignment:
| Q |
156 |
cctctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||||||||||||||||||||||| | | |||||| ||||||||||||||||||| |
|
|
| T |
12885964 |
cctctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt |
12886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 29355936 - 29355853
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
29355936 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
29355853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 12221996 - 12221913
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | || |||| ||||||||||||||||||| |
|
|
| T |
12221996 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 167 - 243
Target Start/End: Original strand, 12892071 - 12892147
Alignment:
| Q |
167 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
12892147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 243
Target Start/End: Complemental strand, 3116204 - 3116126
Alignment:
| Q |
165 |
acaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | |||| |||||||||| | |||||| | |||||| |||||||||||| |
|
|
| T |
3116204 |
acaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctttttt |
3116126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 1347018 - 1347100
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
1347018 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
1347100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 244
Target Start/End: Complemental strand, 2166486 - 2166406
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||| ||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
2166486 |
tacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttttta |
2166406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 244
Target Start/End: Complemental strand, 2178119 - 2178039
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||| ||| || | |||||| |||||||||||||||||||||| |
|
|
| T |
2178119 |
tacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttttta |
2178039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 242
Target Start/End: Original strand, 6808472 - 6808532
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
6808472 |
gtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt |
6808532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 9161178 - 9161262
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||| ||| ||| ||||||||||||| | ||||||||||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
9161178 |
ctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttttt |
9161262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 1354836 - 1354756
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
1354836 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 383834 - 383760
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||| | |||| | | |||||||||||||||| |
|
|
| T |
383834 |
tacaatacaccaaa--ttgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 13267797 - 13267862
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| | |||| | |||||||||||||||||||| |
|
|
| T |
13267797 |
aaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttt |
13267862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 18277256 - 18277190
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| |||| || |||||||| | |||||| |||||||||||| |||||||| |
|
|
| T |
18277256 |
aaatggtgggaccccttcctagactctacgtatgcgggagctttactgcaccgggttgtcctttttt |
18277190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 242
Target Start/End: Original strand, 26097237 - 26097295
Alignment:
| Q |
184 |
gggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
26097237 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
26097295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 2755503 - 2755422
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgg--gctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||| | ||||| ||||||||| |||||| |||||| |||||||||| |
|
|
| T |
2755503 |
ctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Original strand, 2979117 - 2979156
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
144 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2979117 |
tggcccatttctatagtcgggcctctcgggctcgggccgg |
2979156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 21038362 - 21038323
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
144 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21038362 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
21038323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 23930185 - 23930126
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||| | |||||||| |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
23930185 |
gtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt |
23930126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 244
Target Start/End: Original strand, 24097649 - 24097716
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||| || || ||||||||||||||| |
|
|
| T |
24097649 |
aaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctttttta |
24097716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 187 - 242
Target Start/End: Original strand, 25557805 - 25557860
Alignment:
| Q |
187 |
accccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
25557805 |
accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
25557860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 10734963 - 10734905
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| | |||||| | ||||||| |||||||| |
|
|
| T |
10734963 |
gtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 236
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
236 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||| || |||||| | | |||| |||||||||||||| |
|
|
| T |
14975164 |
caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 75 - 112
Target Start/End: Original strand, 2978549 - 2978586
Alignment:
| Q |
75 |
attagagctgtcaaaaatgagccggtccattggcccat |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2978549 |
attagagctgtcaaaaatgggccggtccattgtcccat |
2978586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 17432407 - 17432483
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||| |||||| ||| |||| ||||| || |||| | ||||| | |||||| |||||||||||||||||| |
|
|
| T |
17432407 |
tacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt |
17432483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 24734703 - 24734751
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
24734703 |
tacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgcg |
24734751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
185 |
ggaccccttcccagaccctgcgtatgcgcgggcttta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 243
Target Start/End: Complemental strand, 30786427 - 30786371
Alignment:
| Q |
187 |
accccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||| |||| |||||||||| | |||||| |||||||||||||| |||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgccttttttt |
30786371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 32579497 - 32579541
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggcttta |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||| | |||||| |
|
|
| T |
32579497 |
aaatggtgggaccccttcccagaccctgcatatgcgggagcttta |
32579541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 40)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 10543754 - 10543835
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
10543754 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 14530379 - 14530455
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
14530379 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 10546219 - 10546301
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
10546219 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
10546301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 9671235 - 9671315
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
9671235 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 166 - 241
Target Start/End: Original strand, 23488544 - 23488619
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||| ||||| |
|
|
| T |
23488544 |
caatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt |
23488619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 42808528 - 42808583
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42808528 |
tggcccatttctatattcgggcctctcgggcccgggccggcccatttgacacctct |
42808583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 24200704 - 24200622
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||| ||||||| ||||| | | |||||| ||||||||||||||||||| |
|
|
| T |
24200704 |
ctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 31158519 - 31158437
Alignment:
| Q |
160 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||| | |||||| | |||| | ||| ||||||| |
|
|
| T |
31158519 |
tgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattgtccttttt |
31158437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 8455395 - 8455315
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
8455395 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 14444800 - 14444866
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| |||||| |||||||||||||| |
|
|
| T |
14444800 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttttt |
14444866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 25249817 - 25249735
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | |||||| |||||||| |||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
25249817 |
ctgcgtacaatacaccaaa--tggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttttt |
25249735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 36871548 - 36871629
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
36871548 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36871629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 44643595 - 44643659
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| | || ||| ||||||||| ||||||||| |
|
|
| T |
44643595 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt |
44643659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 11514492 - 11514571
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||||||||||||||||||||| | |||||| |||||||| |||||||||| |
|
|
| T |
11514492 |
ctgcgtacaatacaccaaa--tggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctttt |
11514571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 182 - 245
Target Start/End: Original strand, 34766332 - 34766395
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||| |||||| ||||||||||| |
|
|
| T |
34766332 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttttat |
34766395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 21779335 - 21779260
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
21779335 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 25079775 - 25079717
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
25079775 |
gtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 5841089 - 5841166
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||| ||||||||||| |
|
|
| T |
5841089 |
tacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 40579807 - 40579750
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||| ||||||||||||||||| |
|
|
| T |
40579807 |
gtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 34080178 - 34080237
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | | |||| ||||||||||||||||||| |
|
|
| T |
34080178 |
gtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt |
34080237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 192 - 241
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
| Q |
192 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
22371248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 26684683 - 26684618
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||||| | ||||||||||||||| ||| ||||||| |
|
|
| T |
26684683 |
aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtccttttt |
26684618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 26827039 - 26826982
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26827039 |
cccatttctatagtcgggcctctcgggcccgggctgggccggcccatttgacacctct |
26826982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 40762308 - 40762234
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||||| | ||||||||| |||| ||||||||||||| | | |||||| |||||||||||||||||| |
|
|
| T |
40762308 |
tacaatacaccaaa--tggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 41409939 - 41410000
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | |||| | |||||||||||||||| |||| |
|
|
| T |
41409939 |
gtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccctctttt |
41410000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 105 - 158
Target Start/End: Original strand, 44089183 - 44089236
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacct |
158 |
Q |
| |
|
|||||||||| |||||| |||||||||||| ||||||| | ||||||||||||| |
|
|
| T |
44089183 |
tggcccatttatatagtcgggcctctcggggccgggccaggccatttgacacct |
44089236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 228
Target Start/End: Complemental strand, 44449463 - 44449395
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcacc |
228 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |||||||||| || | | | ||||||||||| |
|
|
| T |
44449463 |
ctgcgtacaatacaccaaaa-tagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 240
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
| Q |
185 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||| ||||||||||||| | | |||||| |||||| ||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt |
8576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 14530325 - 14530384
Alignment:
| Q |
18 |
acgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
76 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
14530325 |
acgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaat |
14530384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 39914363 - 39914305
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||| |||| |||||||||||||| |
|
|
| T |
39914363 |
gtgggaccccttcct-gaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
39914305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 244
Target Start/End: Original strand, 17668058 - 17668141
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| |||||||||||||| | |||| |||||||| | ||||||||||| | | |||||| |||||||||||||||||||||| |
|
|
| T |
17668058 |
ctgcgtacaatacaccaaa--tggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttttta |
17668141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 32781367 - 32781316
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
32781367 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcg |
32781316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 175 - 240
Target Start/End: Original strand, 14544136 - 14544201
Alignment:
| Q |
175 |
aaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||| | |||||| |||||| |||||||||| |
|
|
| T |
14544136 |
aaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 17896332 - 17896397
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||| | | |||||| |||| || |||||||||||| |
|
|
| T |
17896332 |
aaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgcccttttt |
17896397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 23397825 - 23397899
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||||| | ||||||||||||| | |||||| | |||||| | ||| || |||||||||||||||||| |
|
|
| T |
23397825 |
tacaatacaccaaa--tggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 24860067 - 24859985
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | || | |||||||| | ||||||||||||||| | |||||| |||||||| ||||| |||||| |
|
|
| T |
24860067 |
ctgcgtacaatacaccaaa--tggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgccttttttt |
24859985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 24890467 - 24890517
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
211 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
24890467 |
ctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgc |
24890517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 236
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
192 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
236 |
Q |
| |
|
||||| ||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 7214590 - 7214674
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||| |||||| ||| || |||||| | ||| ||||||||||| | | |||| |||||| ||||||| |||||| |
|
|
| T |
7214590 |
ctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgccttttttt |
7214674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 25641562 - 25641639
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| | |||||||||||| | |||||| || ||||| ||| |||||||| |
|
|
| T |
25641562 |
tacaatacaccaaa--ttgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtcctttttt |
25641639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 32)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 38879637 - 38879719
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
38879637 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 43334259 - 43334341
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||| ||||| | |||||| |||||||||||||||||||| |
|
|
| T |
43334259 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgcccttttt |
43334341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 162 - 239
Target Start/End: Complemental strand, 12006406 - 12006329
Alignment:
| Q |
162 |
catacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| |||||| | |||||| ||||||| ||||||||| |
|
|
| T |
12006406 |
catacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 4619185 - 4619103
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
4619185 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 16957375 - 16957450
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
16957375 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 13801848 - 13801767
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||| |
|
|
| T |
13801848 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 24448946 - 24449028
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24448946 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttttt |
24449028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 169 - 240
Target Start/End: Original strand, 25622524 - 25622595
Alignment:
| Q |
169 |
tacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||||||| ||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 27328808 - 27328890
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| |||||||||||||| | ||||||||||| ||| ||||| |||| |
|
|
| T |
27328808 |
ctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgccttttt |
27328890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 32703478 - 32703558
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
32703478 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 39801593 - 39801652
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||||| |||||||||||||| |||| |
|
|
| T |
39801593 |
gtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 16028682 - 16028621
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
16028682 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
16028621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 8170063 - 8169982
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | | || | |||||||||||||||||||| |
|
|
| T |
8170063 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgcccttttt |
8169982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 20135660 - 20135740
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || ||||| | |||| | ||||||||||||||||| |
|
|
| T |
20135660 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 41014374 - 41014454
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
41014374 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
41014454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 29334451 - 29334532
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||| || | ||||||||| ||||| ||||||||||||| | | ||||||||||||||| ||||||||| |
|
|
| T |
29334451 |
ctgcgtacaatacaccagaa-tggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgccctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 34154893 - 34154814
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| ||| || |||||||||||||||||| |
|
|
| T |
34154893 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
165 |
acaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggcttta |
221 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
10306548 |
acaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 12575735 - 12575660
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||| | |||||||||||||| |||||||||||||| | ||||| ||||||||| |||||||| |
|
|
| T |
12575735 |
tacaatacaccaaaa-tggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
| Q |
189 |
cccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||| ||||||| ||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
32354263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 245
Target Start/End: Complemental strand, 11657779 - 11657694
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||| | ||| | ||||| | ||||||| ||||||||||||| |
|
|
| T |
11657779 |
ctgcatacaatacacc-aaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttttttat |
11657694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 16880726 - 16880647
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||| |||| |||||| |||| |||||||||| | |||||| ||||||||||| |||||| |
|
|
| T |
16880726 |
ctgcgtacaatacaccaaa--tggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 28516513 - 28516432
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||| ||||| | ||||||||| ||||||||||||||| |||| | |||||| || ||| |||||||||||| |
|
|
| T |
28516513 |
ctgcgtacaatacatcaaaa-tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 30877622 - 30877564
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||| |||||||| |||| | | ||| || |||||||||||||||||| |
|
|
| T |
30877622 |
gtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 35710383 - 35710449
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| || | ||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
35710383 |
aaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttttt |
35710449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 43574678 - 43574732
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
231 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| |||||||| |
|
|
| T |
43574678 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 237
Target Start/End: Complemental strand, 21784396 - 21784335
Alignment:
| Q |
176 |
aaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccc |
237 |
Q |
| |
|
||||| |||||||||||| || ||||||||||||||| | | |||| ||||||| ||||||| |
|
|
| T |
21784396 |
aaaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 22187341 - 22187422
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||||| | || |||||||||||| ||||| | ||||| | |||||| |||| | ||||||||||| |
|
|
| T |
22187341 |
ctgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttt |
22187422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 141
Target Start/End: Original strand, 34375172 - 34375205
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggcccgggc |
141 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
34375172 |
cccatttctatagtcgggcctctcgggcccgggc |
34375205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 141
Target Start/End: Original strand, 35540634 - 35540667
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggcccgggc |
141 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35540634 |
cccatttctatagtcgggcctctcgggcccgggc |
35540667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 231
Target Start/End: Complemental strand, 209007 - 208936
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
231 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||| ||||||| |||||| | |||||| ||||||||| |
|
|
| T |
209007 |
ctgcattcaatacaccaaaa-tggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 239
Target Start/End: Complemental strand, 29184118 - 29184062
Alignment:
| Q |
183 |
tgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||||| |||| |||||| |||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
29184118 |
tgggactccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 48)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 13628871 - 13628789
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
13628871 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 159 - 245
Target Start/End: Complemental strand, 40272891 - 40272807
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
40272891 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttttat |
40272807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 5173799 - 5173717
Alignment:
| Q |
160 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||| ||||||||||||||| ||||| ||||||||| |||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
5173799 |
tgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
5173717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 45786295 - 45786214
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||| |||| | |||||| |||||||||||||||||| |
|
|
| T |
45786295 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 46421116 - 46421031
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | ||||||| |||||||| |||||||||||| |
|
|
| T |
46421116 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctttttt |
46421031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 54484769 - 54484850
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
54484769 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
54484850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 164 - 243
Target Start/End: Complemental strand, 13730678 - 13730599
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
13730678 |
tacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
13730599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 29366801 - 29366719
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||| | | |||||| ||||| ||||||||||||| |
|
|
| T |
29366801 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 10795504 - 10795423
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||||||||||||||| | |||| | |||||| ||||||||||| |
|
|
| T |
10795504 |
ctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 244
Target Start/End: Complemental strand, 49013554 - 49013469
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || || ||| | |||||| |||||||||||||||||||||| |
|
|
| T |
49013554 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctttttta |
49013469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 353430 - 353351
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||| |
|
|
| T |
353430 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 175 - 242
Target Start/End: Original strand, 516504 - 516571
Alignment:
| Q |
175 |
aaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
516504 |
aaaaatggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
516571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 12914109 - 12914034
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||||| |||||| | |||| ||||||||||||||||||||| |
|
|
| T |
12914109 |
tacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 212
Target Start/End: Complemental strand, 45139557 - 45139505
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
45139557 |
ctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcg |
45139505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 52926298 - 52926216
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| ||||||||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
52926298 |
ctgcgtacaatacaccaaa--tggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttttt |
52926216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 243
Target Start/End: Complemental strand, 8247763 - 8247683
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||| ||||||||||||||| | ||||||| ||||| |||||||||| |||| |
|
|
| T |
8247763 |
tacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccctatttt |
8247683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9144865 - 9144810
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9144865 |
tggcccatttctataggcaggcctctcgggctcgggccggcccatttgacacctct |
9144810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 245
Target Start/End: Original strand, 15797298 - 15797382
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||| | | ||| || ||||||||||||||||||||||| |
|
|
| T |
15797298 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttttttat |
15797382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 25517249 - 25517169
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||| || ||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
25517249 |
ctgcgtacaatacac--aaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 53996645 - 53996563
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| ||| ||||||||| | | |||||| ||||||||| |||||||||| |
|
|
| T |
53996645 |
ctgcttacaatacaccaaaa-tggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgcccttttt |
53996563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 24851364 - 24851298
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| || ||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
24851364 |
aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttttt |
24851298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 14987035 - 14987116
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||| ||||| |||| ||| |||||| | |||||| ||||||||||| |||||| |
|
|
| T |
14987035 |
ctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 22122996 - 22122918
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||| |
|
|
| T |
22122996 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 22609843 - 22609921
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
22609843 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 26869784 - 26869866
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||| || |||| |||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
26869784 |
ctgcgtacaatacaccaaa--tggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttttt |
26869866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 39203597 - 39203671
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||| ||| |||||| | |||||| |||||||||||||||||| |
|
|
| T |
39203597 |
tacaatacaccaaa--tggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 1217166 - 1217247
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | | ||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
1217166 |
ctgcgtacaatacaccaaa--tggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
1217247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
| Q |
185 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10484615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 34771443 - 34771362
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||| |||||||||| |
|
|
| T |
34771443 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttt |
34771362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 50462768 - 50462708
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50462768 |
tggcccatttctatagtcgggcctctcgggcttgggccgggccggcccatttgacacctct |
50462708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 25944552 - 25944630
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||||||||| | | |||||| ||||| || ||||||||||| |
|
|
| T |
25944552 |
tacaatacaccaaaa-tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctttttt |
25944630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 30452894 - 30452953
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
30452894 |
gtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 192 - 243
Target Start/End: Original strand, 47624208 - 47624259
Alignment:
| Q |
192 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
47624259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 198 - 244
Target Start/End: Complemental strand, 4495718 - 4495672
Alignment:
| Q |
198 |
gaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
4495718 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccctttttta |
4495672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 31592925 - 31593004
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
31592925 |
ctgcgtacaatacaccaaa--tggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 29322878 - 29322821
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29322878 |
cccatttctatagtcgggcctctcgggcttgggccgggccggcccatttgacacctct |
29322821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 244
Target Start/End: Complemental strand, 829517 - 829438
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||||||||| | |||||| |||||||| || ||||||||| |
|
|
| T |
829517 |
tacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccggtctgtcctttttta |
829438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 243
Target Start/End: Original strand, 40390357 - 40390401
Alignment:
| Q |
199 |
accctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
40390401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 230
Target Start/End: Complemental strand, 45948917 - 45948848
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgg |
230 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| | ||||||||||||||| | |||||| |||||||| |
|
|
| T |
45948917 |
ctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 229
Target Start/End: Complemental strand, 6411901 - 6411833
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccg |
229 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||| |||||||||| | |||||| ||||||| |
|
|
| T |
6411901 |
ctgcgtacaatacaccaaa--tgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 16735518 - 16735598
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||| ||||||||||| |||| | ||||| ||||||||||||| |
|
|
| T |
16735518 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 54032613 - 54032570
Alignment:
| Q |
198 |
gaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
54032613 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54032570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 243
Target Start/End: Original strand, 12525493 - 12525567
Alignment:
| Q |
169 |
tacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||| ||||||| |||||| |||||||| |||| || | |||| | |||||| |||||| ||||||| |
|
|
| T |
12525493 |
tacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctctttttt |
12525567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 245
Target Start/End: Complemental strand, 54374425 - 54374340
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
|||| |||||| |||||||| | ||||||||||||||| |||||||| |||||| | |||||| | |||| || |||| |||||||| |
|
|
| T |
54374425 |
ctgcgtacaatccaccaaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgccattttttat |
54374340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 26573226 - 26573287
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| | |||||| |||||| || |||||| |||| |
|
|
| T |
26573226 |
gtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccctctttt |
26573287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 243
Target Start/End: Original strand, 10300591 - 10300651
Alignment:
| Q |
183 |
tgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||| |||||||||||||| |||||||| | ||||||||| || || ||||| |||||| |
|
|
| T |
10300591 |
tgggactccttcccagaccctacgtatgcgggagctttaatgtactggattgccttttttt |
10300651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 31372521 - 31372465
Alignment:
| Q |
109 |
ccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
31372521 |
ccatttctatagtcgggcctctcggacccgagccgggccggcccatttgacacctct |
31372465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 55140549 - 55140585
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggcccgggccgg |
144 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
55140549 |
cccatttctatagtcgggcctctcggacccgggccgg |
55140585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 59033 - 59114
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| | |||||| |||| ||||||||||||| |
|
|
| T |
59033 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 13082 - 13022
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
13082 |
gtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgcccttttt |
13022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 61)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 20639738 - 20639655
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
20639738 |
ctgcgtacaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
20639655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 30352661 - 30352577
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||| | ||||||||||||||| | |||||| ||||||| ||||||||||||| |
|
|
| T |
30352661 |
ctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttttt |
30352577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 163 - 243
Target Start/End: Complemental strand, 33836564 - 33836484
Alignment:
| Q |
163 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||| | |||||| |||| |||||||||||||||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttt |
33836484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 23501848 - 23501927
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
23501848 |
tacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
23501927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 171 - 240
Target Start/End: Complemental strand, 44363199 - 44363130
Alignment:
| Q |
171 |
caccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
44363199 |
caccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 20225130 - 20225211
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||| |
|
|
| T |
20225130 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 16408682 - 16408598
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| |||| |||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
16408682 |
ctgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
16408598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 13256480 - 13256397
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||| || | |||| | |||||| |||||||||||||||||||| |
|
|
| T |
13256480 |
ctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgcccttttt |
13256397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 16911618 - 16911700
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||| ||| | |||||| | |||||||||||||||| |
|
|
| T |
16911618 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 21647020 - 21647098
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccc |
237 |
Q |
| |
|
|||| ||||||| ||||| ||| ||||||||||||||||||||| || |||||| | |||||| ||||||||||||||| |
|
|
| T |
21647020 |
ctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 38755966 - 38755908
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
38755966 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 16494273 - 16494326
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
16494273 |
ctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcg |
16494326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 182 - 243
Target Start/End: Original strand, 32484310 - 32484371
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| |||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
32484310 |
gtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt |
32484371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 5648314 - 5648395
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||||| |||||||||||||| |
|
|
| T |
5648314 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttttt |
5648395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 11394924 - 11394987
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
11394924 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 11404651 - 11404714
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||| || ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
11404651 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 25629110 - 25629186
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||| | |||||| | |||||| |||||||||||||||||||| |
|
|
| T |
25629110 |
tacaatacaccaaa--tggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcccttttt |
25629186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 20225038 - 20225117
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
20225038 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 25388253 - 25388311
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
25388253 |
gtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 30690255 - 30690176
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| |||||| || |||||||| |
|
|
| T |
30690255 |
ctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 38786681 - 38786747
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
38786681 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
38786747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 40553991 - 40553937
Alignment:
| Q |
186 |
gaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
40553991 |
gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 44718644 - 44718702
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
44718644 |
gtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 49268805 - 49268746
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggc----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49268805 |
tggcccatttctatagtcgggcctctcgggctaggccgggccggcccatttgacacctct |
49268746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 6430705 - 6430627
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | |||||||| |||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
6430705 |
ctgcgtacaatacaccaaa--tggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 9987913 - 9987831
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
9987913 |
ctgcatacaatacaccaaa--tggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgggctgccttttttt |
9987831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 10660460 - 10660544
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||| | ||||||| |||| |||||||||| ||||| |
|
|
| T |
10660460 |
ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccccttttt |
10660544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 10874605 - 10874689
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaa-tgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| ||| |||||||||||| | ||||||| |||| |||||||||| ||||| |
|
|
| T |
10874605 |
ctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccccttttt |
10874689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 30639435 - 30639517
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||| ||||||||||| |||||||| |||||| | |||||| ||||| ||||||||||||||| |
|
|
| T |
30639435 |
ctgcgtacaatacaccaaa--tggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttttt |
30639517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 190 - 243
Target Start/End: Original strand, 35532077 - 35532130
Alignment:
| Q |
190 |
ccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
35532130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 20908716 - 20908633
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| |||||||||||||| | |||||| ||||| || ||||||||||| |
|
|
| T |
20908716 |
ctgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttttt |
20908633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 29207977 - 29207900
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||| |
|
|
| T |
29207977 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 36816464 - 36816381
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||| ||||||| ||||||| | |||||| || |||||||||||||||||| |
|
|
| T |
36816464 |
ctgcgtacaatacaccaaaaag-gtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttttt |
36816381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 54175119 - 54175202
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggacccctt-cccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||| ||| |||||||| |||||| | |||||| ||||||||| |||||||||| |
|
|
| T |
54175119 |
ctgcgtacaatacaccaaaa-tggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgcccttttt |
54175202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 244
Target Start/End: Original strand, 35567242 - 35567309
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||| | |||||| ||||||||| |||||||||||| |
|
|
| T |
35567242 |
aaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttttta |
35567309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 51865117 - 51865037
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||| ||||||||| ||||||||||||||| | |||||| |||||||| ||||||||| |
|
|
| T |
51865117 |
ctgcgtacaatacaccaaa--tggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgccctttt |
51865037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 239
Target Start/End: Complemental strand, 7909355 - 7909281
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgg-gctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||| || |||||| |||| |||||||||||| |
|
|
| T |
7909355 |
tacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 11054227 - 11054145
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | | || |||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
11054227 |
ctgcgtacaatacaccaaa--tggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
11054145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 28972588 - 28972531
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28972588 |
cccatttctatagtcgggcctctcgggcccgggctgggccggcccatttgacacctct |
28972531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 40915884 - 40915962
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | |||||| |||||||| ||||||||||||||| | |||| | |||||||| |||||||| |
|
|
| T |
40915884 |
ctgcgtacaatacaccaaa--tggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 47444013 - 47444095
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| ||||| | |||| | ||||| ||||||||||||||| |
|
|
| T |
47444013 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcaggagcttcagtgcactgggttgccctttttt |
47444095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 241
Target Start/End: Complemental strand, 47482918 - 47482849
Alignment:
| Q |
172 |
accaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| | ||||| |||| || | ||||||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt |
47482849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 47528609 - 47528527
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||| |||| | | ||| || ||||||||||||||||||||| |
|
|
| T |
47528609 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttttt |
47528527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 244
Target Start/End: Original strand, 54730314 - 54730391
Alignment:
| Q |
167 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||||||||| ||| ||| |||||||||| ||||||||||||||| | |||||| ||||||| || |||||||||| |
|
|
| T |
54730314 |
aatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccgaattaccctttttta |
54730391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1763429 - 1763369
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1763429 |
tggcccatttcaatagtcgggcctctcgggcccgagccgggccggcccatttgacacctct |
1763369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 8473701 - 8473621
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccaga--ccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| | |||||| |||||| | |||||| ||||||||||||||||| |
|
|
| T |
8473701 |
ctgcatacaatacaccaaa--tggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 9832392 - 9832311
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| ||||| | || || |||||||||||||||||||| |
|
|
| T |
9832392 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgcccttttt |
9832311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 14983906 - 14983970
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| || ||| ||||||||||| |
|
|
| T |
14983906 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 20405148 - 20405224
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||| ||||| || |||||| | |||||| |||| |||||||||||| |
|
|
| T |
20405148 |
tacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 227
Target Start/End: Complemental strand, 41018868 - 41018807
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcac |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
41018868 |
tacaatacaccaaa--tagtgggaccccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 242
Target Start/End: Complemental strand, 48598904 - 48598823
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| ||| ||||| | ||| || |||||||||||||||||||| |
|
|
| T |
48598904 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Original strand, 6377622 - 6377661
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
144 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
6377622 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
6377661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Original strand, 28185587 - 28185626
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccgg |
144 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28185587 |
tggcccatttctatagtcgggcctctcgggcccgagccgg |
28185626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Original strand, 8820585 - 8820615
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8820585 |
gtgggaccccttcccagaccctgcgtatgcg |
8820615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 243
Target Start/End: Original strand, 28494223 - 28494289
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||| | ||| || ||||||||| |||| |||||| |
|
|
| T |
28494223 |
aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgccttttttt |
28494289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 17043473 - 17043423
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
211 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
17043473 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgcatatgc |
17043423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 164 - 221
Target Start/End: Complemental strand, 49938668 - 49938612
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggcttta |
221 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||| |||||| | |||||| |
|
|
| T |
49938668 |
tacaatacaccaaaa-tggtgggaccccttcccataccctgcatatgcgggagcttta |
49938612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 50555714 - 50555653
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||| |||||||||||||| | | |||| ||||||||| ||||||||||| |
|
|
| T |
50555714 |
gtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctttttt |
50555653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 21489143 - 21489218
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgc |
235 |
Q |
| |
|
|||| |||||| |||||||| | ||||||||||||||| |||||||||||||| | ||||| ||||| ||||||| |
|
|
| T |
21489143 |
ctgcgtacaatgcaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 25343243 - 25343327
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||||| || ||||||||||| ||| |||||||||| | | |||||| ||||| || ||||| ||||| |
|
|
| T |
25343243 |
ctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggctgccccttttt |
25343327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 28185042 - 28185086
Alignment:
| Q |
68 |
acgtacaattagagctgtcaaaaatgagccggtccattggcccat |
112 |
Q |
| |
|
||||| || ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
28185042 |
acgtagaagtagagctgtcaaaaatgggccggcccattggcccat |
28185086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 42)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 39461075 - 39460993
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| ||| ||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
39461075 |
ctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 12625946 - 12626026
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||| ||||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
12625946 |
ctgcatacaatacaccaaa--tggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 16013515 - 16013593
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||||| |||||| | |||||| |||||||||||| ||||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttt |
16013593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 244
Target Start/End: Original strand, 35261740 - 35261818
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||||||||||||| | |||||||||||||| ||||||||||||||| | |||||| |||||||||||||||||||||| |
|
|
| T |
35261740 |
tacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttta |
35261818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 7136608 - 7136524
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| ||||||||||| ||||||||| |
|
|
| T |
7136608 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctttttt |
7136524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 20869979 - 20870063
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||| ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
20869979 |
ctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
20870063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 6760883 - 6760962
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| | ||||| || |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
6760883 |
tacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt |
6760962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 234
Target Start/End: Complemental strand, 20284150 - 20284075
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttg |
234 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
20284150 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 159 - 234
Target Start/End: Complemental strand, 21070778 - 21070703
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttg |
234 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
21070778 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 26954189 - 26954271
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||||| || |||||| | |||||| ||||| ||||||||||||| |
|
|
| T |
26954189 |
ctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 243
Target Start/End: Original strand, 26102577 - 26102655
Alignment:
| Q |
163 |
atacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
26102577 |
atacaatacaccaaa--tggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttttt |
26102655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 243
Target Start/End: Complemental strand, 8897838 - 8897761
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | |||||| |||||| |||||||||||||| |
|
|
| T |
8897838 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttttt |
8897761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 28817684 - 28817624
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||| ||||||||||||||| |
|
|
| T |
28817684 |
gtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgcccttttt |
28817624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 25250578 - 25250661
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| |||| || |||||| | | |||| |||||||||||||||||||| |
|
|
| T |
25250578 |
ctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgcccttttt |
25250661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 240
Target Start/End: Original strand, 28407475 - 28407538
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||| |||||| |||||||| | |||||| |||||||||||||||||| |
|
|
| T |
28407475 |
aaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 36720852 - 36720932
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
36720852 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Original strand, 44530205 - 44530285
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||||||||||||| | |||||| |||||||||||| |||||| |
|
|
| T |
44530205 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctttt |
44530285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 227
Target Start/End: Complemental strand, 44781580 - 44781517
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcac |
227 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||| | |||||| ||||| |
|
|
| T |
44781580 |
tacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 13160757 - 13160836
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||| |||||||||||||| |
|
|
| T |
13160757 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 29521764 - 29521685
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | |||||| ||| |||||||||||||||||||| | |||||| ||||||||||||| |||| |
|
|
| T |
29521764 |
ctgcgtacaatacaccaaa--tggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 30454160 - 30454094
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
30454160 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
30454094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 12670329 - 12670247
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||| ||||||||| |
|
|
| T |
12670329 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctttttt |
12670247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 16225075 - 16225156
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||| ||| |||||| |||||||| ||||| || |||||| | |||||| |||||||||||| ||||| |
|
|
| T |
16225075 |
ctgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtccttt |
16225156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 45071320 - 45071398
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||| |||||||||| | |||| | ||||||||||||||||| |
|
|
| T |
45071320 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 27468141 - 27468089
Alignment:
| Q |
191 |
cttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
27468089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 37698567 - 37698620
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37698567 |
tggcccatttctatagtcgggcctc--ggggccgggccggcccatttgacacctct |
37698620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 27507987 - 27508044
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| |||||||||||| |||| |
|
|
| T |
27507987 |
gtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 43942380 - 43942421
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagac |
200 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43942380 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccagac |
43942421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 242
Target Start/End: Original strand, 10857906 - 10857966
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||| ||||| |||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
10857906 |
gtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
10857966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 18405319 - 18405374
Alignment:
| Q |
107 |
gcccatttctatagttgggcctctcgggcccgggccggc--ccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
18405319 |
gcccatttctatagtcgggcctctcgggcctgagccggcggccatttgacacctct |
18405374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 27127153 - 27127213
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggc-----ccgggccggcccatttgacacctct |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27127153 |
tggcccatttctatagtcgggcctctcgggcttgggccgggctggcccatttgacacctct |
27127213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 29877150 - 29877227
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | || ||| |||||| || |||||| |
|
|
| T |
29877150 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 31457252 - 31457308
Alignment:
| Q |
185 |
ggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
||||||||||||| |||||||||||||| | ||| || |||||||| |||||||||| |
|
|
| T |
31457252 |
ggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttt |
31457308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 35107374 - 35107310
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||| ||| ||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 242
Target Start/End: Complemental strand, 5135363 - 5135288
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||| | ||||| ||||||||| |||||||||| |
|
|
| T |
5135363 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtgcaccgggctgcccttttt |
5135288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 22598164 - 22598223
Alignment:
| Q |
18 |
acgggttcatatcctggaaacaacctctt-tataaaaagcggggtaaggctacgtacaat |
76 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||||| | ||||||||||| ||||||| |
|
|
| T |
22598164 |
acgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaat |
22598223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 2626578 - 2626657
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| |||||| | |||| | |||||| | ||||||||| |
|
|
| T |
2626578 |
ctgcgtacaatacaccaaa--tgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 242
Target Start/End: Complemental strand, 18164808 - 18164758
Alignment:
| Q |
192 |
ttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||| ||||||||||||||| | |||||| |||||||||||||| ||||| |
|
|
| T |
18164808 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 231
Target Start/End: Complemental strand, 8483996 - 8483947
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
8483996 |
gtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 165
Target Start/End: Original strand, 30232764 - 30232820
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggcccgggccggcccatttgacacctctgcata |
165 |
Q |
| |
|
||||||| | ||||||||||||||| ||| ||||| ||||||||||||||||| |||| |
|
|
| T |
30232764 |
cccatttatgtagttgggcctctcgagcc-gggccagcccatttgacacctctacata |
30232820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 44598998 - 44598941
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
44598998 |
cccatttctatagtcgggcctctcgggtccgggctgggccggcccatttgacacctct |
44598941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 141
Target Start/End: Original strand, 10730432 - 10730468
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggcccgggc |
141 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10730432 |
tggcccatttctatagtcgggcctctcggacccgggc |
10730468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 46892 - 46969
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
46892 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
46969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 46786 - 46703
Alignment:
| Q |
160 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||||||||||||| | ||||||||||| | || ||||| |||||| |
|
|
| T |
46786 |
tgcatacaatataccaaaa-tggtgggaccccttcccagaccctgcgtatgcgggagctttaatgcatcaggctgcccattttta |
46703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 24835 - 24769
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| | |||||| |||| | |||||||||||||| |
|
|
| T |
24835 |
aaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctttttt |
24769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 40)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 164 - 242
Target Start/End: Original strand, 42805585 - 42805663
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| || |||||| | |||||| |||||||||||||||||||| |
|
|
| T |
42805585 |
tacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
42805663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 7879694 - 7879776
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | |||| | ||||||||||||||||||||| |
|
|
| T |
7879694 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttttt |
7879776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 244
Target Start/End: Complemental strand, 27889395 - 27889312
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttta |
244 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| ||||||||||||||| | ||||| | |||||||||||||||||||| |
|
|
| T |
27889395 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttttta |
27889312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 42391179 - 42391097
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
42391179 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
42391097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 243
Target Start/End: Original strand, 43557528 - 43557613
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggc-tttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||| |||| ||| ||||||||||| | || |||| ||||||||||||||||||||| |
|
|
| T |
43557528 |
ctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctttttt |
43557613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 47716515 - 47716596
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || |||||| | ||||| |||||||||||||||||| |
|
|
| T |
47716515 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 164 - 243
Target Start/End: Original strand, 32758320 - 32758397
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||||| |
|
|
| T |
32758320 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt |
32758397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 239
Target Start/End: Complemental strand, 3469251 - 3469176
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||| ||||||| | |||||| ||| | ||||||||||| |
|
|
| T |
3469251 |
tacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 21172088 - 21172008
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
21172088 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 236
Target Start/End: Complemental strand, 33871989 - 33871914
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
236 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||||||||||| ||||||| | |||||| |||||| ||||||| |
|
|
| T |
33871989 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 164 - 241
Target Start/End: Complemental strand, 35787343 - 35787268
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||||||||||||| | | ||||||||||||| |||| |||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
35787343 |
tacaatacaccaaa--tggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccctttt |
35787268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 36602535 - 36602585
Alignment:
| Q |
193 |
tcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt |
36602585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 48735201 - 48735122
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||| |
|
|
| T |
48735201 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 38262274 - 38262193
Alignment:
| Q |
160 |
tgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| || ||||||||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
38262274 |
tgcatacaatacaccaaa--tgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctttttt |
38262193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 45019006 - 45018923
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaa--tagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||| |||||||| | |||| |||||||||| ||||||||||||||| | |||||| |||||| ||||||||||| |
|
|
| T |
45019006 |
ctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 2541082 - 2541019
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||| | |||||| ||||||||||| |||||| |
|
|
| T |
2541082 |
aaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 39123957 - 39124000
Alignment:
| Q |
167 |
aatacaccaaaaatagtgggaccccttcccagaccctgcgtatg |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
39123957 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
39124000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 10693152 - 10693073
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||| |||||||||||| |
|
|
| T |
10693152 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 22699049 - 22698967
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccc-cttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| ||||| ||||||| ||||||| | ||| || ||||||||||| |||||| |
|
|
| T |
22699049 |
ctgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttacccttt |
22698967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 23419753 - 23419674
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| ||||| ||||| |||| |||||||| |||| |||| |||||||| |
|
|
| T |
23419753 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 243
Target Start/End: Complemental strand, 34626271 - 34626205
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||| | |||||| | || |||||||||||||||| |
|
|
| T |
34626271 |
aaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttttt |
34626205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 11617667 - 11617589
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
11617667 |
ctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 33500569 - 33500622
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcg |
212 |
Q |
| |
|
|||| ||| |||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33500569 |
ctgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcg |
33500622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 18512511 - 18512455
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
18512511 |
gtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 31591172 - 31591108
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||| |||| ||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
31591172 |
aaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 238
Target Start/End: Complemental strand, 35334874 - 35334818
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||| ||||||||||| |||| |
|
|
| T |
35334874 |
gtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 40463948 - 40464012
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||||| | |||| | ||||||| ||||||||||| |
|
|
| T |
40463948 |
aaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttt |
40464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 42798725 - 42798806
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||||| |||||||| |||||| | ||| || |||| ||||||||||||||| |
|
|
| T |
42798725 |
ctgcgtacaatacaccaaa--tggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgcccttttt |
42798806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 243
Target Start/End: Original strand, 25198810 - 25198864
Alignment:
| Q |
189 |
cccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
||||||||||||||| |||||| | | |||||| ||||||||||||| ||||||| |
|
|
| T |
25198810 |
cccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcactttttt |
25198864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 239
Target Start/End: Original strand, 29907482 - 29907552
Alignment:
| Q |
166 |
caatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
||||||||||||| | |||||||||| |||| ||||||| |||||| | |||||| ||||||||||||||||| |
|
|
| T |
29907482 |
caatacaccaaaa-tggtgggaccccatcccggaccctg--tatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 18747564 - 18747621
Alignment:
| Q |
182 |
gtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctt |
239 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||| ||||||||| ||||||| |
|
|
| T |
18747564 |
gtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 19426968 - 19426887
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| ||| | |||||||| |||||| | |||| | ||||||||||||||||||||| |
|
|
| T |
19426968 |
ctgcgtacaatacaccaaa--tggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctttttt |
19426887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 242
Target Start/End: Complemental strand, 23619040 - 23618975
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||| ||| | |||||| |||| ||||||||||||||| |
|
|
| T |
23619040 |
aaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttt |
23618975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 242
Target Start/End: Original strand, 27629706 - 27629771
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| ||||||||||||||| | |||||| |||||| |||| | |||||||||||||||||||| |
|
|
| T |
27629706 |
aaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgcccttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 231
Target Start/End: Original strand, 21566491 - 21566562
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccggg |
231 |
Q |
| |
|
|||| ||||||||||||||| | || |||||||||||| ||||||| |||||| | |||||| ||||||||| |
|
|
| T |
21566491 |
ctgcgtacaatacaccaaaa-tggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 27697528 - 27697572
Alignment:
| Q |
194 |
cccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||||||| |||||| |
|
|
| T |
27697528 |
cccagaccctgcgtatgcgggagcttaaatgcaccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Original strand, 45261872 - 45261904
Alignment:
| Q |
105 |
tggcccatttctatagttgggcctctcgggccc |
137 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
45261872 |
tggcccatttctatagtcgggcctctcgggccc |
45261904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 245
Target Start/End: Original strand, 45811919 - 45811986
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttttat |
245 |
Q |
| |
|
|||| |||||| ||||| ||||||||||| ||||| | |||||| |||| |||||||||||||||||| |
|
|
| T |
45811919 |
aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttttttat |
45811986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 46354250 - 46354302
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgc |
211 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||| ||||| || ||||| |
|
|
| T |
46354250 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 243
Target Start/End: Complemental strand, 47077929 - 47077852
Alignment:
| Q |
164 |
tacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||| ||||| | |||||| | ||| || |||||||| ||||| |||||| |
|
|
| T |
47077929 |
tacaatacac--aaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgccttttttt |
47077852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 159 - 242
Target Start/End: Original strand, 30633 - 30714
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttttt |
242 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||||||||||||||| |
|
|
| T |
30633 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 159 - 241
Target Start/End: Complemental strand, 48713 - 48633
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || ||||||||||||||||||| |
|
|
| T |
48713 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 243
Target Start/End: Complemental strand, 24212 - 24130
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttttt |
243 |
Q |
| |
|
|||| |||||||||||||| | ||||||||||||||| |||||||| |||||| | ||| || |||||||| |||||||||||| |
|
|
| T |
24212 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttttt |
24130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 10882 - 10946
Alignment:
| Q |
177 |
aaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccctttt |
241 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| | |||||| ||||| ||||||| ||||| |
|
|
| T |
10882 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 236
Target Start/End: Complemental strand, 1666 - 1591
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcc |
236 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||||| ||||||||| | |||||| |||||| ||||||| |
|
|
| T |
1666 |
ctgcatacaatacaccaaa--tgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 10129 - 10052
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||||||| ||||| | ||| | |||||||||||||||| |
|
|
| T |
10129 |
ctgcgtacaatacaccaaa--tagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 238
Target Start/End: Complemental strand, 20457 - 20380
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgccct |
238 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |||||||| ||||| | ||| | |||||||||||||||| |
|
|
| T |
20457 |
ctgcgtacaatacaccaaa--tagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 11185 - 11264
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | ||||||| ||||||| |||||||| |||||| | ||| || |||||| ||||||||||| |
|
|
| T |
11185 |
ctgcttacaatacaccaaa--tggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 72946 - 72867
Alignment:
| Q |
159 |
ctgcatacaatacaccaaaaatagtgggaccccttcccagaccctgcgtatgcgcgggctttaatgcaccgggttgcccttt |
240 |
Q |
| |
|
|||| |||||||||||||| | || | |||||||||| || |||||||||||| | |||||| |||||| ||||||||||| |
|
|
| T |
72946 |
ctgcctacaatacaccaaa--tggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 4232 - 4289
Alignment:
| Q |
108 |
cccatttctatagttgggcctctcgggccc-----gggccggcccatttgacacctct |
160 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4232 |
cccatttctatagtcgggcttctcgggcccgggctgggccggcccatttgacacctct |
4289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University