View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_low_45 (Length: 238)
Name: NF20174_low_45
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 202
Target Start/End: Original strand, 33494842 - 33495034
Alignment:
| Q |
10 |
aagaatataaaactagttttagcaattcaactaagtttatgcttgaataaaaaatcatttaaatttttataagagcaccatatagcgtcaaaagttgctt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33494842 |
aagaaaataaaactagttttagcaattcaactaagtttatgcttggataaaaaatcatttaaatttttatatgagcaccatatagcgtcaaaagttgctt |
33494941 |
T |
|
| Q |
110 |
tcccatcataagctcaaaatacagataaaacaaaatcgctaatgtgaatgtcataacttatgatcatccatgtacaaagaatagcagtccata |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33494942 |
tcccatcataagctcaaaatacagataaaacaaaatcactaatgtgaatgtcataacttatgatcatccatgtacaaagaatagtagtccata |
33495034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University