View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_high_27 (Length: 265)
Name: NF20175_high_27
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 7546001 - 7545753
Alignment:
| Q |
1 |
gaaagtgtctagcctaacaatatcgacactatgggaagagacatgccttgaatatgagcttttcttcatcctggcttccttcttttatcttgaatatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7546001 |
gaaagtgtctagcctaacaatatcgacactatggaaagagacatgccttcaatatgagcttttcttcatcttggcttccttcttttatcttgaatatatt |
7545902 |
T |
 |
| Q |
101 |
ttgtcaaaaattattttgattatccgtttgaagtttatcaccatttgcctactggcaggtcaactaaaactcaattcttgnnnnnnnnctttctttcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7545901 |
ttgtcaaaaattattttgattatccgtttgaagtttatcaccacttgcctactggcaggtcaactaaaactcaattcttg-tttttttctttctttcaag |
7545803 |
T |
 |
| Q |
201 |
aaactgtatatcttcattaattgcttctaaccaattttgacatgaattgt |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7545802 |
aaactgtatatcttcgttaattgcttctaaccaattttgacatgaattgt |
7545753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University