View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_high_29 (Length: 262)
Name: NF20175_high_29
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 2772433 - 2772637
Alignment:
| Q |
1 |
tatatcatagatatgcttcttcttgcactcgtatgaaatgtgcatagcggtaactgtttcaatttctgatttactcttttttaataatattttcgaattc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2772433 |
tatatcattgatatgcttcttcttgcactcgtatgaaatgtgcatagcggtaactgtttcaatttctgatttactc-tttttaataatattttcgaattc |
2772531 |
T |
 |
| Q |
101 |
aacctattcataactaaaaatcgctcactttgaa---aacaacaatagttttagataaacaaacatcaagaaaggtatatttcggcagtgtcattgactc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2772532 |
aacctattcataactaaaaatcgctcactttgaaaacaacaacaatagttttagataaacaaacatcaagaaaggtatatttgggcagtgtcattgactc |
2772631 |
T |
 |
| Q |
198 |
tcattt |
203 |
Q |
| |
|
|||||| |
|
|
| T |
2772632 |
tcattt |
2772637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 223 - 253
Target Start/End: Original strand, 2773058 - 2773088
Alignment:
| Q |
223 |
ggtttgtgacagcctctttcaatgttcatct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2773058 |
ggtttgtgacagcctctttcaatgttcatct |
2773088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University