View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_low_27 (Length: 298)
Name: NF20175_low_27
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 61 - 298
Target Start/End: Complemental strand, 22582052 - 22581815
Alignment:
| Q |
61 |
atactcaaaagatgccgatgtatctttgtttttcaccctattaaatttttatatttggaggctaattggtccttttttctggtttaattatcaggacaag |
160 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22582052 |
atactcaaaagatgctgatgtatctttgtttttcaccctatttaatttttatatttggaggctaattggtcctttgttctggtttaattatcaggacaag |
22581953 |
T |
 |
| Q |
161 |
cctgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatgtgaattattgcctacaattgactggtagttgttt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22581952 |
cctgagccaccaccagagggtcgcttgcctgatgccaccaagggtaagtgttctggacttgcgatgtgaattattgcctacaattgactggtagttgttt |
22581853 |
T |
 |
| Q |
261 |
ggctcattatttgattcttgatttttgcaggctctgac |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22581852 |
ggctcattatttgattcttgatttttgcaggttctgac |
22581815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 1780544 - 1780491
Alignment:
| Q |
153 |
aggacaagcctgagccaccaccagagggtcgcttgcctgatgccaccaagggtt |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
1780544 |
aggacaagcctgagccaccattagagggtcgcttgcctgatgctaccgagggtt |
1780491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 226
Target Start/End: Original strand, 12348652 - 12348718
Alignment:
| Q |
160 |
gcctgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatg |
226 |
Q |
| |
|
|||||||||||||||||| | |||||| | |||||| || ||||||||||||||| || |||||||| |
|
|
| T |
12348652 |
gcctgagccaccaccagatgatcgctttcttgatgcaacaaagggttagtgttcttgatttgtgatg |
12348718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 25282354 - 25282417
Alignment:
| Q |
163 |
tgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatg |
226 |
Q |
| |
|
||||||||||||||| | |||||| | |||||| || ||||||||||||||| || |||||||| |
|
|
| T |
25282354 |
tgagccaccaccagatgatcgctttcttgatgcaacaaagggttagtgttcttgatttgtgatg |
25282417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University