View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_low_29 (Length: 286)
Name: NF20175_low_29
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 269
Target Start/End: Complemental strand, 45763253 - 45762999
Alignment:
| Q |
15 |
caaaggctgatgagcgttaccggcgatcaaaaacatcatgaagaagacgcattgaagttgttaccggagaatataggtggtggcgctggtggaggtggtt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45763253 |
caaaagctgatgagcgttaccggcgatcaaaaacatcatgaagaagacgcattgaagttgttaccggagaatataggtggtggtgctggtggaggtggtt |
45763154 |
T |
|
| Q |
115 |
cttcgggttctggatcgttgctggaccatggtattgatttctctttgctgcagagtaaaacaagcaacggtggatttggatcgttggattggaatggtga |
214 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763153 |
cttctggttctggatcgttgatggaccatggtattgatttctctttgctgcagagtaaaacaagcaacggtggatttggatcgttggattggaatggtga |
45763054 |
T |
|
| Q |
215 |
tggtagtgctgatcatcaaggtttgtttgatcttcctaacaccgttgatcatggt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763053 |
tggtagtgctgatcatcaaggtttgtttgatcttcctaacaccgttgatcatggt |
45762999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University