View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_low_43 (Length: 230)
Name: NF20175_low_43
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_low_43 |
 | |
|
| [»] scaffold0470 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 125
Target Start/End: Complemental strand, 6756558 - 6756452
Alignment:
| Q |
19 |
actagcttgaagaacaccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatataattt |
118 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6756558 |
actagcttgcacaacgccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatatgcttt |
6756459 |
T |
|
| Q |
119 |
aaccatt |
125 |
Q |
| |
|
||||||| |
|
|
| T |
6756458 |
aaccatt |
6756452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 35 - 125
Target Start/End: Complemental strand, 6658710 - 6658620
Alignment:
| Q |
35 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatataatttaaccatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6658710 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatatgctttaaccatt |
6658620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 35 - 125
Target Start/End: Complemental strand, 6739112 - 6739022
Alignment:
| Q |
35 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatataatttaaccatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6739112 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatatgctttaaccatt |
6739022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 35 - 125
Target Start/End: Complemental strand, 6749751 - 6749661
Alignment:
| Q |
35 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatataatttaaccatt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6749751 |
ccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatatgctttaaccatt |
6749661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 6615225 - 6615131
Alignment:
| Q |
19 |
actagcttgaagaacaccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatat |
113 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
6615225 |
actagcttgcacaacgccaccaggtggattagtggcaagtgaaaatgtcagagttgcgatcagggaagctgttaaacttatgctacctttcatat |
6615131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 126
Target Start/End: Original strand, 19059473 - 19059580
Alignment:
| Q |
19 |
actagcttgaagaacaccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatataattt |
118 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
19059473 |
actagcttgcacaacgccaccaggtggattagtggcaagtgaaaatgtcagagttgcgattagggaagctgttaaacttatgctacttttcatatctttt |
19059572 |
T |
|
| Q |
119 |
aaccattc |
126 |
Q |
| |
|
|||||||| |
|
|
| T |
19059573 |
aaccattc |
19059580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0470 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0470
Description:
Target: scaffold0470; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 4511 - 4417
Alignment:
| Q |
19 |
actagcttgaagaacaccaccaggtggattagtggcaagtgaaaatgtcatagttgcgattatggaagctgttaaacttatgctacctttcatat |
113 |
Q |
| |
|
||||||||| | ||| |||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
4511 |
actagcttgcacaacgccaccaggtggattagtggcaagtgaaaatgtcagagttgcgatcagggaagctgttaaacttatgctacctttcatat |
4417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University