View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_low_46 (Length: 208)
Name: NF20175_low_46
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_low_46 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 31243542 - 31243732
Alignment:
| Q |
18 |
tgtgcttagaaattctcttaaaaagtgaggattaatggaagcatgtattggatggcagagctgcattggttcaaaatcttgaaatccttccccaagtaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31243542 |
tgtgcttagaaattctcttaaaaagtgaggattaatggaagcatgtagtggatggcagagctgcattggttcaaaatctgaaaatccttccccaagtaag |
31243641 |
T |
|
| Q |
118 |
ccatccctctcaccatcagcatcaatgtccatattgttggtcccatcatttgcatcggtgggtgcaaaacaacgaaccaaatagacagtat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31243642 |
ccatccctctcaccatcagcatcaatgtccatattgttggtcccatcatttgtatcggtgggtgcataacaacgaaccaaatagacagtat |
31243732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 120
Target Start/End: Original strand, 7206789 - 7206843
Alignment:
| Q |
66 |
tggatggcagagctgcattggttcaaaatcttgaaatccttccccaagtaagcca |
120 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7206789 |
tggatgacagcgctgcattggttcaaaatctggaaatccttccccaactaagcca |
7206843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University