View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20175_low_47 (Length: 204)
Name: NF20175_low_47
Description: NF20175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20175_low_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 23229666 - 23229467
Alignment:
| Q |
10 |
aagaatatgatagcttgtatagttgaagaaagcatgcttgattttagtattttttcactta--ggtattaatattatttgcttagtgattcatatcaagg |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23229666 |
aagaaaatgatagcttgtatagttgaagaaagcatgattgattttagtatttttttacttaaaggtattaatattatttgcttagtgattcatatcaagg |
23229567 |
T |
 |
| Q |
108 |
tgatatatacacatatatatagataatgaaagcgcgtcaaacatttttattactttaagaactttctttaggata---aattattctcaagttattacct |
204 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
23229566 |
tgatacatgcacatatatatagataatgaaagcgcgtcaatcatttttattactttaagaactttctttaggataaataattattcacaagttattacct |
23229467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University