View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20176_low_2 (Length: 275)
Name: NF20176_low_2
Description: NF20176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20176_low_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 275
Target Start/End: Complemental strand, 18841073 - 18840806
Alignment:
| Q |
11 |
agagatgaaaacaatgatgcaagatcaaaggaataaggttgtaatggaaaagttgaagaaatcttttttgcttcgatatgcggcaatgaaccctagttct |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||| |||| |||| |||||| |
|
|
| T |
18841073 |
agagttgaaaacaatgatgcaagatcaaaggaaggaggttgtaatggaaaagttgaagaaatctttcttgcttcgttatgcgggaatggacccaagttct |
18840974 |
T |
|
| Q |
111 |
agctccatcatcaactctccaaacctctcctcttttcttgacgagcgtcttccacaacttttcaatgacttccacactcc---tgatcaccctccttatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18840973 |
agctccatcatcaactctccaaacctctcctcttttcttgacgagcgtctaccacaacttttcaatgacttccacactcctgatgatcaccctccttatc |
18840874 |
T |
|
| Q |
208 |
attgggtttgtacctttgttgttcttatttcctttgattttacttgatgataatttatataacttttt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18840873 |
attgggtttgtacctttgttgttcttattttctttgattttacttgatgataatttatataacttttt |
18840806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University