View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_high_20 (Length: 402)
Name: NF20177_high_20
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 18 - 398
Target Start/End: Original strand, 35525746 - 35526126
Alignment:
| Q |
18 |
ataattagatagtatacaaaatgaattaatattgcattttaataagaaaattaagaaatcacaagagaaaggtaaaccggtgaattatgtattcaaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35525746 |
ataattagatagtatacaaaatgaattaatattgcattttaataagaaaattaagaaatcacaagagaaaggtaaaccggtgaattatgtattcaaattc |
35525845 |
T |
 |
| Q |
118 |
caaatgctattctctgtacaaagtctggacgtctcttgctaggcattctaactagaccagtgatctgcagctctgtaattcccctgcaaaatcgcgctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35525846 |
caaatgctattctctgtacaaagtctggacgtctcttgctaggcattctaactagaccagtgatctgcagctctgtaattcccctgcaaaatcgcgctct |
35525945 |
T |
 |
| Q |
218 |
gtgacaaaccaaagttaaggattgtgacaagtataaccaaaatgcattgcaatcactatagctctattaatgcacttgaagcattatgccccgtgctatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35525946 |
gtgacaaaccaaagttaaggattgtgacaagtataaccaaaatgcattgcaatcactatagctctattaatgcacttgaagcattatgccccgtgctatc |
35526045 |
T |
 |
| Q |
318 |
atgttgtttgaaatgaaaaatataaaggatactggattgaggcttcattttggtctgcagatccactcatttcttctctct |
398 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
35526046 |
atgttatttgaaatgaaaaatataaaggatactggattgaggcttcattttggtctgcagatccattcatttcttttctct |
35526126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University