View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_high_47 (Length: 257)
Name: NF20177_high_47
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 42485241 - 42485005
Alignment:
| Q |
16 |
caatttcaaaactagactatacatgctgctttcacatggccatagatcacccaagtcactcaaaatgcaatttatcatgacacattcttaactacagaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485241 |
caatttcaaaactagactatacatgctgctttcacatggccatagatcatccaagtcactcaaaatgcaatttatcatgacacattcttaactacagaca |
42485142 |
T |
 |
| Q |
116 |
gaaatagttttggaatttaccccaaaatcaaaattttaactaggcttcttgtgtgccatttccatctacacaccattcaaacaggtaccagtaacattaa |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42485141 |
gaaatagttttagaatttaccccaaaatcaaaattttaactaggcttcttgtgtgccatttccatctacacaccattcaaacaggtaccagtaacattaa |
42485042 |
T |
 |
| Q |
216 |
acatttgttagtacataaccaatgagcctatgcttct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42485041 |
acatttgttagtacataaccaatgagcctattcttct |
42485005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University