View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_high_54 (Length: 240)
Name: NF20177_high_54
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_high_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 25772320 - 25772114
Alignment:
| Q |
17 |
tagaaaaggttaccctatccaaaagtgggccacaaccacagtgtgtctgccgcttgattagaaaaataatccatcaccgcccgcctaacctcggttggag |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25772320 |
tagaaaaggttacgctatccaaaagtgggccacaaccacagtgtgtctgccacttgattagaaaaataatccatcaccgcccgcctaacctaggttggag |
25772221 |
T |
|
| Q |
117 |
actccacccaaacannnnnnnaccttaagttcactatagggagggcaaccaagttgccaatgctctggctatggacaaagcctacctccttttgcctcac |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
25772220 |
actccacccaaaca-ccccccaccttaagttcactatagggagggcaaccaagttgccaatgctcaggctatggacaaagcgtacctccttttgcctcaa |
25772122 |
T |
|
| Q |
217 |
agtggtgg |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
25772121 |
agtggtgg |
25772114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University