View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_20 (Length: 438)
Name: NF20177_low_20
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 330; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 77 - 423
Target Start/End: Original strand, 37676564 - 37676916
Alignment:
| Q |
77 |
cttccacttcccattcatatctctcccaaaccagacacagttttcgttttcccacaattaagttaccttctttcagcaacaataaccgtaataaccaccg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676564 |
cttccacttcccattcatatctctcccaaaccagacacagttttcgttttcccacaattaagttaccttctttcagcaacaataaccgtaataaccaccg |
37676663 |
T |
 |
| Q |
177 |
tgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatttgactgtgacggtgtcatcttggaatctgagcacttacatcgtcag |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676664 |
tgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatttgactgtgacggtgtcatcttggaatctgagcacttacatcgtcag |
37676763 |
T |
 |
| Q |
277 |
gcttataacgatgcatttcttcacttcaatgttcgttctc------cttcttcttcttctcaaccactcaactgggatatagaattctatgatcaacttc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676764 |
gcttataacgatgcatttcttcacttcaatgttcgttctccttcttcttcttcttcttctcaaccactcaactgggatatagaattctatgatcaacttc |
37676863 |
T |
 |
| Q |
371 |
agaaccaaattggcggtggcaaacccaaaatgcgatggttccataaatttctt |
423 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676864 |
agaaccaaattggcggtggcaaacccaaaatgcgatggttccataaatttctt |
37676916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 37676488 - 37676535
Alignment:
| Q |
1 |
atgatgaagatgactggttaatggttaatgaacatgaccatggcttct |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37676488 |
atgatgaagatgaatggttaatggttaatgaacatgaccatggcttct |
37676535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University