View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_36 (Length: 310)
Name: NF20177_low_36
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 12 - 296
Target Start/End: Complemental strand, 51115378 - 51115094
Alignment:
| Q |
12 |
aatactggccttacaccagcgcaacttgtttctcataatcacgaacaagttgcttttttccttgaaaactccctaaggatgtttgaagtacgacttgaga |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115378 |
aatactggccttacaccatcgcaacttgtttctcataatcacgaacaagttgcttttttccttgaaaactccctaaggatgtttgaagtacgacttgaga |
51115279 |
T |
|
| Q |
112 |
gccttgaagacttcgttgttttatcaggactcaagtgcataatttctatgctatttttcacctatatttattcggtcgtgttggcaacaaatatgccaac |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115278 |
gccttggagacttcgttgttttatcaggactcaagtgcataatttctatgctatttttcacctatatttattcggtcgtgttggcaacaaatatgccaac |
51115179 |
T |
|
| Q |
212 |
gctaacaactacaaccggcctttttggttggtttggagcgttacttgctactgttggatttgtgatgtttcatatgtgtagcaag |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51115178 |
gctaacaactacaaccggcctttttggttggtttggagcgttacttgctactgttggatttgtgatgtttcatatgtgtagcaag |
51115094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 294
Target Start/End: Complemental strand, 51105636 - 51105568
Alignment:
| Q |
226 |
ccggcctttttggttggtttggagcgttacttgctactgttggatttgtgatgtttcatatgtgtagca |
294 |
Q |
| |
|
|||||||||||| |||||||||| |||||| ||||||||||| || |||||| | ||| |||||||| |
|
|
| T |
51105636 |
ccggcctttttgcatggtttggagtgttactagctactgttgggttgttgatgtcttataggtgtagca |
51105568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 299
Target Start/End: Original strand, 48037243 - 48037347
Alignment:
| Q |
195 |
gcaacaaatatgccaacgctaacaactacaaccggcctttttggttggtttggagcgttacttgctactgttggatttgtgatgtttcatatgtgtagca |
294 |
Q |
| |
|
|||||||||||||||| ||| ||| | || | ||||| |||| |||||||||| ||| ||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
48037243 |
gcaacaaatatgccaaagctgacagcatcagctggcctctttgcatggtttggagtgttgcttgctactgttggattggtgatgttttataggtgtagca |
48037342 |
T |
|
| Q |
295 |
agtga |
299 |
Q |
| |
|
|||| |
|
|
| T |
48037343 |
ggtga |
48037347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University