View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_45 (Length: 274)
Name: NF20177_low_45
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 6634791 - 6634548
Alignment:
| Q |
14 |
caaagggtaggtacaattacaaagataaaaaggaaggttattagggtnnnnnnnnnnnnggagaatataacaggggggcaaaagggtgggagaagagaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634791 |
caaagggtaggtacaattacaaagataaaaaagaaggttattagggtaaaaacaaaaaaggagaatataacaggggggcaaaagggtgggagaagagaat |
6634692 |
T |
 |
| Q |
114 |
gatggtagtgactggtgtgtcacagtgactgcaaaagaagcaggacataggaccagaggggtgcagtgactcagtgtgttggtgagcaattgcgtacaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634691 |
gatggtagtgactggtgtgtcacagtgactgcaaaagaagcaggacataggaccagaggggtgcagtgactcagtgtgttggtgagcaattgcgtacaga |
6634592 |
T |
 |
| Q |
214 |
aggactcttttcaattaatgtattccctcacaccttctgtcact |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6634591 |
aggactcttttcaattaatgtattccctcacaccttctgtcact |
6634548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University