View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_56 (Length: 244)
Name: NF20177_low_56
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 4 - 235
Target Start/End: Complemental strand, 44218277 - 44218046
Alignment:
| Q |
4 |
tagtgtctctaactcctacggctacagtccatcactctnnnnnnnnnnnnntcaccaattcaaagttagcatttgtagacaaggtagaatgggctggaac |
103 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44218277 |
tagtgtctctaactcctactgctacagtccatcactctcccccatcccctctcacccattcaaagttagcatttgtagacaaggtagaatgggctggaac |
44218178 |
T |
 |
| Q |
104 |
ataacatatcggttctgttacgtgcttgatacataaagcagggcaagaaacttagaaatggtacaatttggttctattaaaatatgaaatttgagagaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44218177 |
ataacatatcggttctgttacgtgcttgatacataaagcagggcaagaaacttagaaatggtacaatttggttccattaaaatatgaaatttgagagaag |
44218078 |
T |
 |
| Q |
204 |
acaacggtataggctggtccgccttcatgccc |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
44218077 |
acaacggtataggctggtccgtcttcatgccc |
44218046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University