View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_60 (Length: 237)
Name: NF20177_low_60
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 32184000 - 32183794
Alignment:
| Q |
13 |
atgaagaaaaaaggtttggtagttaaggaatgggtggatcaaagtgagattttgagtcacaaaagtataggaggatttgtgagtcattgtggatggaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184000 |
atgaagaaaaaaggtttggtagttaaggaatgggtggatcaaagtgagattttgagtcacaaaagtataggaggatttgtgagtcattgtggatggaact |
32183901 |
T |
 |
| Q |
113 |
caattatggaggcagctttgaatggtgtgccaatattggcttggccacaacatggtgatcaaaggataaatgcagggttggttgagattagtggatgggg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32183900 |
caattatggaggcagctttgaatggtgtgccaatattggcttggccacaacatggtgatcaaaggataaatgcagggttggttgagattagtggatgggg |
32183801 |
T |
 |
| Q |
213 |
gatttgg |
219 |
Q |
| |
|
||||||| |
|
|
| T |
32183800 |
gatttgg |
32183794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 28 - 213
Target Start/End: Complemental strand, 32176818 - 32176633
Alignment:
| Q |
28 |
ttggtagttaaggaatgggtggatcaaagtgagattttgagtcacaaaagtataggaggatttgtgagtcattgtggatggaactcaattatggaggcag |
127 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |||||| | ||||| ||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
32176818 |
ttggtggttaaagaatgggtggatcaaagtgagattttgagtcataaaagtgttggagggtttgtgagtcattgtggatggaactcaattacagaagcag |
32176719 |
T |
 |
| Q |
128 |
ctttgaatggtgtgccaatattggcttggccacaacatggtgatcaaaggataaatgcagggttggttgagattagtggatggggg |
213 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||||||| ||||| | |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
32176718 |
ctttgaatggtgtaccaattttgggttggccacaacatggagatcagaagataaatgcaaagttggtggagattagtggatggggg |
32176633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University