View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20177_low_62 (Length: 235)
Name: NF20177_low_62
Description: NF20177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20177_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 44218279 - 44218489
Alignment:
| Q |
5 |
agtgcgttaagtttcatatatcaaaccgtagcagatagcaatagtgggctgttgacctaatcataggttgttttcctttgagatagtcaacttttgaagg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44218279 |
agtgcgttaagtttcatatatcaaaccgtagcagatag------tgggctgttgacctaatcataggttgttttcctttgagatagtcaacttttgaagg |
44218372 |
T |
 |
| Q |
105 |
ctctatcgtgagccaaacctaacaacgggttttgtaattttgcacaacctcacccatcatcgggagtgagtattcttactgctgatgggaataaaaagga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44218373 |
ctctatcgtgagccaaacctaacaacgggttttgtaattttgcactacctcacccatcatcgggagtgagtattcttactgctgatgggaataaaaagga |
44218472 |
T |
 |
| Q |
205 |
acaaggattgttattca |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44218473 |
acaaggattgttattca |
44218489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University