View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20178_low_6 (Length: 384)
Name: NF20178_low_6
Description: NF20178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20178_low_6 |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 4709 - 5062
Alignment:
| Q |
1 |
ttttaaatataatatatagaatagcttcagctctgctatagcctaaggttcacatgaaatcccaaatattattcttttctctcatgaaaggtaaaattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4709 |
ttttaaatataatatatagaatagcttcagctctgctatagcctaaggttcacatgaaatcccaaatattattcttttctctcatgaaaggtaaaattgg |
4808 |
T |
 |
| Q |
101 |
taaaggaagattggattcatataattgataagttttttatgtgaccacgttactaaatgatgggttgaagggacaaatgcaacacttatatgtatttaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4809 |
taaaggaagattggattcatataattgataagttttttgtgtgaccacgttactcaatgatgggttgaagggacaaatgcaacacttatatgtatttaag |
4908 |
T |
 |
| Q |
201 |
tgacatttaataattgctctactaatgttttcataaactatcttgtgagtgcagatctgcactcgtatgaaaatatgttcaaaacagcttataaacatac |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| || | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4909 |
tgacatttaataattgctctactaatg-tttcataaactatcttg-gacgg------------tgtatgaaaatatgttcaaaacagcttataaacatat |
4994 |
T |
 |
| Q |
301 |
gataagatattttcttaagctcttctcattcccaacattactccctccgtttttacatacatattttt |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4995 |
gataagatattttcttaagctcttctcattcccaacattactccctccgtttttacatacatgttttt |
5062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University