View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_high_56 (Length: 320)
Name: NF20179_high_56
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_high_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 303
Target Start/End: Original strand, 45180782 - 45181071
Alignment:
| Q |
13 |
aatataaatggttgttaagagttcgatataaatagctcggttgacaagagaagggtcgacaaaggaatttaatttggagtaggagatcacatgttgatcc |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45180782 |
aatataaatggttgttaaaagttcgatataagtagttcggttggcaagagaagggtcgacgaaggaatttaatttggagtagaagatcacatgttgatcc |
45180881 |
T |
|
| Q |
113 |
ccgaaaattaactactactaacatattgaatatttatcgatttttatattatttttctctccattcatgagagatctacatttatttgtatacggtattg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45180882 |
ccgaaaattaactactactaacatattgaatatttatcgatttttatattatttttctctccattcatgagagatctacatttatttgtatacggtattg |
45180981 |
T |
|
| Q |
213 |
gaatactgannnnnnnngtctctaactaccatttattctttatttaatgnnnnnnncaacatgaaacttgaaacacaagtcccaaccaaac |
303 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45180982 |
gaatactga-tttttttgtctctaaataccatttattctttatttaatgaaaaaaacaacatgaaacttgaaacacaagtcccaaccaaac |
45181071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University