View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_high_66 (Length: 268)
Name: NF20179_high_66
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 5228774 - 5228636
Alignment:
| Q |
8 |
tgagatgaatcgaaataacttttggctcagctggcgagaaaccgagccaattacaaactaaatgccataaagaatgattatatataattgaatatacaac |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
5228774 |
tgagatgagccgaaataacttttggctcagctggcgagaaaccgagccaattacaaactaaatgccacagggaatgattatatataattgaatatacaac |
5228675 |
T |
 |
| Q |
108 |
atatatcactccatagtgcgtaagaggttactctagttg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5228674 |
atatatcactccatagtgcgtaagaggttactcttgttg |
5228636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 5228643 - 5228599
Alignment:
| Q |
208 |
tcttgttgttgtgtaaacgttctccaagtctcaatactttgtagg |
252 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
5228643 |
tcttgttgttgtgtaaaccttctccaagtctcaatactttatagg |
5228599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University