View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_low_59 (Length: 317)
Name: NF20179_low_59
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 22 - 161
Target Start/End: Original strand, 42159150 - 42159289
Alignment:
| Q |
22 |
aaaactgaaaaatgaaacaaaatttgtagagaatatttgtcaaaaataacaataaattcataatgatatgatatgttatatgtgtcagcattgatttcat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159150 |
aaaactgaaaaatgaaacaaaatttgtagagaatatttgtcaaaaataacaataaattcataatgatatgatatgttatatgtgtcagcattgatttcat |
42159249 |
T |
|
| Q |
122 |
tccaagttgcatagtaccccatctgtcatcacatcatcat |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42159250 |
tccaagttgcatagtactccatctgtcatcacatcatcat |
42159289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 214 - 301
Target Start/End: Original strand, 42159347 - 42159434
Alignment:
| Q |
214 |
cctgcaaccaccgtcacaacaacccttcttcgccactatttccctaagcttttctaaaaatctcttttttctcactgatcctttaact |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159347 |
cctgcaaccaccgtcacaacaacccttcttcaccactatttccctaagcttttctaaaaatctcttttttctcactgatcctttaact |
42159434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University