View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_low_73 (Length: 254)
Name: NF20179_low_73
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 55370542 - 55370785
Alignment:
| Q |
1 |
tcttgtagtagattctctccataatttgtg-aaagcttcacaattcagaaagcaaaaaagagatcaatagtttacgattaaagaaaccatagtgagggaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55370542 |
tcttgtagtagattctctccataatttgtgcaaagcttaacaattgagaaagaaaaaaagagatcaatagtttacgattaaagaaactatagtgagggaa |
55370641 |
T |
|
| Q |
100 |
taataaaagcaaaaggaggtcctcaaaaaagcaacaacacttgcagatataattattattctctcatacttcaagctttaaaattcttagaccaattttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55370642 |
taataaaagcaaaaggaggtcctcaaaaaagcaacaacacttgcagatataattattattctctcatacttcaagctttaaaattcttagaccacttttg |
55370741 |
T |
|
| Q |
200 |
actcaaaaaccatcaacctagtatctgttcatgcattcatctct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55370742 |
actcaaaaaccatcaacctagtatctgttcatgcattcatctct |
55370785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University