View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_low_78 (Length: 244)
Name: NF20179_low_78
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 38 - 226
Target Start/End: Complemental strand, 40958591 - 40958403
Alignment:
| Q |
38 |
actaaagttggcaatgatccatnnnnnnntttgcttggccaaataggatacaaagacaaccagatggacatagccctagaaaatcacaaggaaaaactcc |
137 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
40958591 |
actaaagttggcaatgatccataaaaaaatttgcttggccaaataggatacaaagacaaccagatggacataaccctaggaaatcacaaggaaaaactcc |
40958492 |
T |
|
| Q |
138 |
caagccagcaaaagtgccacaagctttttgaaacaggtaactaccaaatccaagttaaagaagaattggatcgagtttgttaattaatt |
226 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40958491 |
caagccagcaaaagtgccacaaactttttgaaacaggtaactaccaaatccaagttaaagaagaattggatcgagtttgttgattaatt |
40958403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University