View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_low_80 (Length: 239)
Name: NF20179_low_80
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_low_80 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 153 - 239
Target Start/End: Complemental strand, 28414911 - 28414824
Alignment:
| Q |
153 |
aattgaaaaatcttctaaaattaactaattagtttaagcccatgtacttgatattagcaccct-tgtttttccaatacacttccctat |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28414911 |
aattgaaaaatcttccaaaattaactaattagtttaagcccatgtacttgatattagcaccctcggtttttccaatacacttccctat |
28414824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 28415098 - 28415048
Alignment:
| Q |
1 |
tactcaagctaggcttcatacccaaaaaagctactcaaattatatatatat |
51 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28415098 |
tactcaagctaggcttcataccccaaaaagctactcaaattatatatatat |
28415048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 97
Target Start/End: Complemental strand, 28415015 - 28414967
Alignment:
| Q |
49 |
tattctggatttttagtttttgagaaatatgcgtactgtagtcgtgttc |
97 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28415015 |
tattctagttttttagtttttgagaaatatacgtactgtagtcgtgttc |
28414967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University