View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20179_low_84 (Length: 236)
Name: NF20179_low_84
Description: NF20179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20179_low_84 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 55370322 - 55370102
Alignment:
| Q |
1 |
acttgcactgcaagtaactcaactagctgtaactaacttgttgaattacaactaatttaacacacataccccattcttagcctatacaaatatatctaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55370322 |
acttgcactgcaagtaactcaactaactgtaactaacttgttgaattacaactaatttaacacacatacccgattcttagcctatacaaatatatctaat |
55370223 |
T |
|
| Q |
101 |
ttgaattacacttcaacactcccgcttatttcaaattatctaggctaatcacatgcatcttcctcatgtctttgaacttttctatcttcaatggcttggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55370222 |
ttgaattacacttcaacactcccgcttatttcaaattctctaggctaatcacatgcatcttcctcatgtctttgaacttttctatcttcaatggcttggt |
55370123 |
T |
|
| Q |
201 |
aagaacatctgcagcttgatc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55370122 |
aagaacatctgcagcttgatc |
55370102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University