View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2017_high_1 (Length: 368)
Name: NF2017_high_1
Description: NF2017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2017_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 39 - 353
Target Start/End: Complemental strand, 47121556 - 47121242
Alignment:
| Q |
39 |
taatatctaccatacaatttatttatttatttatttctcttgggacacttgttaagttgttaacactattcacatgagattccccacattatttgttcat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47121556 |
taatatctaccatacaatttatttatttatttatttctcttgagacacttgttaagttgttaacactattcacatgagattccccacattatttgttcat |
47121457 |
T |
 |
| Q |
139 |
tgtctttttgtgcttattggtggagtgtgattgggtaattgggtatgtacaaacacatccaacaaggtcagttttcaagctccaacagcagtatatgcgc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47121456 |
tgtctttttgtgcttattggtggagtgttattgggtagttgggtttgtacaaacacatccaacaaggtcagttttcaagctccaacagcagtatatgcgc |
47121357 |
T |
 |
| Q |
239 |
ttagcaaagcatccaattcgctgtttgtgcgcgatagcttttgatcataatcatccactctacttccccatatttcaggaatcacttctgcaagtgtaac |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47121356 |
ttagcaaagcatccaattcgctgtttgtgcgcgatagcttttgatcataatcatccactctacttccccatatttcaggaatcacttctgcaagtgtaac |
47121257 |
T |
 |
| Q |
339 |
actgttcacacattc |
353 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
47121256 |
actattcacacattc |
47121242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University