View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2017_high_8 (Length: 228)
Name: NF2017_high_8
Description: NF2017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2017_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 36640884 - 36640666
Alignment:
| Q |
1 |
gcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36640884 |
gcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgctagtttgcaattcaaaat |
36640787 |
T |
|
| Q |
101 |
ttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640786 |
ttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgatag |
36640687 |
T |
|
| Q |
201 |
gtgggattgtgttgatgatgt |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
36640686 |
gtgggattgtgttgctgatgt |
36640666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 36633518 - 36633305
Alignment:
| Q |
1 |
gcagatgctttagcaaaacgtggcgtgaatatggaggggcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaat |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36633518 |
gcagatgctttagcaaaaagtggcgtgaatatggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgctagtttgcaattcaaaat |
36633419 |
T |
|
| Q |
101 |
ttattttgcagaaatagagaaatctatttgtatatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgatag |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36633418 |
ttattttacagaaatagagaaatctatttgtatatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtggggtgtgtttagctgatag |
36633319 |
T |
|
| Q |
201 |
gtgggattgtgttg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36633318 |
gtgggattgtgttg |
36633305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University