View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2017_low_4 (Length: 411)
Name: NF2017_low_4
Description: NF2017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2017_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 11 - 369
Target Start/End: Original strand, 2410780 - 2411125
Alignment:
| Q |
11 |
catcatcaggacggcgtttatcaggtttggtgaggtcgacaaacttaggtgcttcgatcttctcgtagaaatcgtcgtcaatttctatttcctcttcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2410780 |
catcatcaggacggcgtttatcaggtttggtgaggtcgacaaacttaggtgcttcgatcttctcgtagaaatcgtcgtcaatttctatttcctcttcttc |
2410879 |
T |
 |
| Q |
111 |
aattataggcaagaatcgattttctgacattattttgttaacaaaagaaaagtgttacagtaacacagtgttgtttttgttttggtgtttgtaacaacaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2410880 |
aattataggcaagaatcgattttctgacattattttgttaaga--------gcgttacagtaacacagtgttgtttttgttttggtgtt-gtaacaacaa |
2410970 |
T |
 |
| Q |
211 |
gtttagattgttcgaagaattttaaagtcccgtgtaactagccgttacgattcagacaggctggtagtaagagaataaaagaaacggtattcaagggttc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2410971 |
gtttagattgttcgaagaattttaaagtcccgtgtaactagccgttacgattcagacaggctg---gtaagagaataaaagaaacggtattcaagggttc |
2411067 |
T |
 |
| Q |
311 |
ttttcgtcatttcgaggttgaaattgggcttgaggttggtctcgacccgagaccaaatg |
369 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2411068 |
ttttcgtcatttcga-gttcaaattgggcttgaggttggactcgacccgagaccaaatg |
2411125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University