View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20180_high_7 (Length: 270)
Name: NF20180_high_7
Description: NF20180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20180_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 47570921 - 47570684
Alignment:
| Q |
20 |
attgcgcgcccttgaactctaattcatgtgtatttcactgaacatctgtgttattagactttatccccgaaacatggctttctcattgttatgtttctct |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47570921 |
attgcgcgccattgaactctaattcatgtgtatttcactgaacatctgtgttattagactttatccccaaaacatggctttctcattgttatgtttctct |
47570822 |
T |
|
| Q |
120 |
gaacatgtgctatcactttagagatttagtggatgaagataatggtggatacagtttgatatcattcaactgtgcagatgatcagtttatgttaggccac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47570821 |
gaacatgtgctatcactttagagatttagtggatgaagataatggtggatacagtttgatatcattcaactgtgcagatgatcagtttatgttaggccac |
47570722 |
T |
|
| Q |
220 |
ttaccacgtatacgtaccactcagctttgcagtataat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47570721 |
ttaccacgtatacgtaccactcagctttgcagtataat |
47570684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University