View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20181_high_2 (Length: 259)
Name: NF20181_high_2
Description: NF20181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20181_high_2 |
 | |
|
| [»] scaffold1519 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1519 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 79 - 245
Target Start/End: Complemental strand, 258 - 92
Alignment:
| Q |
79 |
ccctgagtttgtggggggaaggataaggtctatagagtacttaaactcgttaatattgtatttctgccagctttgcagttagttacacttccatttgtat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
258 |
ccctgagtttgtggggggaaggataaggtctatagagtacttaaactcgttaatattgtatttctgccagctttgcagttagttacactcccatttgtat |
159 |
T |
|
| Q |
179 |
gccagctcatcagttggttacatttgtctttctgttgaaggcagttgcaaactgtacgaaattattg |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
158 |
gccagctcatcagttggttacagttgtctttctgttgaaggcagttgcaaactgtacgaaattattg |
92 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 11 - 82
Target Start/End: Complemental strand, 436 - 365
Alignment:
| Q |
11 |
cataggtaactgaacattttctttgtgggagaaaaggttcttagcaagtccttaattgtttcctatgtccct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436 |
cataggtaactgaacattttctttgtgggagaaagggttcttagcaagtccttaattgtttcctatgtccct |
365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University