View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20183_high_47 (Length: 222)

Name: NF20183_high_47
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20183_high_47
NF20183_high_47
[»] chr7 (1 HSPs)
chr7 (21-206)||(10246966-10247151)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 21 - 206
Target Start/End: Original strand, 10246966 - 10247151
Alignment:
21 tatggtcttccctatcatgctcctgaacatcaacatagtactgaacacatgtttgaaggtagaagcttctcaagtcaatcatctgattcacagtctccgg 120  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
10246966 tatggtcttccctatcatgctcctgaacgtcaacatagtactgaacacatgtttgaaggtacaagcttctcaagtcaatcatctgattcacagtctccgg 10247065  T
121 tgcgttcgaaccaccatcagtccgatgttgggaattcttccttgccagttattcagcaagaaaacaataatcaaacaaatgaccaa 206  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
10247066 tgcgttcaaaccaccatcagtccgatgtcgggaattcttccttgccagttattcagccagaaaacaataatcaaacaaatgaccaa 10247151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University