View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_high_48 (Length: 216)
Name: NF20183_high_48
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_high_48 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0200 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 28958 - 28779
Alignment:
| Q |
17 |
caaaggcatggagaggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28958 |
caaaggcatggagaggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga |
28859 |
T |
|
| Q |
117 |
tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28858 |
tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatat |
28779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University