View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_15 (Length: 392)
Name: NF20183_low_15
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 21303094 - 21302890
Alignment:
| Q |
15 |
caaaggataatatatcgttcggaagaaccaattttaattccttgatgaatcaattcttagatagactataattatttcatgaccgaactctagattatta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21303094 |
caaaggataatatatcgttcggaagaaccaattttaattctttagtgaatcaattcttagatagactataattatttcatgaacgaactctagattat-- |
21302997 |
T |
|
| Q |
115 |
taagaactccttctctaaaaataggagtgttaacacggacaaaaaaggtaatttaaaataagaaattggaattatcacttttgtcaatagagatccaata |
214 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
21302996 |
-aagaactccttcttcaaaaataagagtgttaacacggacaaaaaaggtaatttaaaataagaaatcgggattatcacttttgtcaatagagatccaata |
21302898 |
T |
|
| Q |
215 |
cctatcac |
222 |
Q |
| |
|
| |||||| |
|
|
| T |
21302897 |
catatcac |
21302890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 240 - 296
Target Start/End: Complemental strand, 21302896 - 21302840
Alignment:
| Q |
240 |
atatcacttttgtgaatcgggattatcacttctctaaattaattttacatcgacatc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21302896 |
atatcacttttgtgaatcgggattatcacttctctaaattaattttacaccgacatc |
21302840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University