View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_22 (Length: 328)
Name: NF20183_low_22
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 172 - 315
Target Start/End: Complemental strand, 373512 - 373369
Alignment:
| Q |
172 |
caatatagacgttcttctccatggtgaagggagaagggatccaaatttctagagagggaaatgatggctgccaaggagagaaatctatagagaagtcaga |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
373512 |
caatatagacgttcttctccatggtgaagggagaagggatccaaatttctagagagcgaaatgatggctgccaaggagagaaacctatagagaagtcaga |
373413 |
T |
 |
| Q |
272 |
actagaaattttggccttctggtaactataatatggtgaaatat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373412 |
actagaaattttggccttctggtaactataatatggtgaaatat |
373369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 373698 - 373543
Alignment:
| Q |
17 |
cttactaggtagctttagcatcttgctgcaatgatgcaatattgagtaactgctcaccagaaaaggtttctttgatgcttccgtcatcttttgcttctat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
373698 |
cttactaggtagctttagcatcttgctgcaatgatgcaatattgagtaactgctcaccagaaaaggtttctttgacgcttccgtcatcttttgcttc--t |
373601 |
T |
 |
| Q |
117 |
ttattccggtatcctagaacgatgattcgtaatatgattttcccacaattcctctcaa |
174 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
373600 |
ttcttccggtatcctagaacgatgattcgtaatatgattttcccgcaattcctctcaa |
373543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University