View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_27 (Length: 288)
Name: NF20183_low_27
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 2719738 - 2719458
Alignment:
| Q |
1 |
gagagggttttattt-tggtgacaatgaggccactagaggccgatttgcgaccacaaagaatggtggtagctagggtttgcaaagagaaaagagaga--c |
97 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
2719738 |
gagagggttttatttgtggtgacagtgaggccactcgaggccgatttgcgaccacaaagaatggtggtagctaaggtttgcaaagagaaaagagagagac |
2719639 |
T |
 |
| Q |
98 |
aaaaaggtgattttattgattcatttacaaacagaaaatgccctttcagattatttcttctcatcccctaatat-----annnnnnnnnactaaatggca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2719638 |
aaaaaggtgattttattgattcatttacaaacagaaaatgccctttcagattatttcttctcatcccataatatttttattttttttttactaaatggca |
2719539 |
T |
 |
| Q |
193 |
ctcacaaagaaaaggcccactatcaagattaatctaaacaattttttatgttgttttgaaatgaccaaggtgagggtttgt |
273 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2719538 |
ctcacaaagaaaaggcccaccatcaagattaatctaaacaattttttatgttgttttgaaatgaccaaggtgagggtttgt |
2719458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University