View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_41 (Length: 247)
Name: NF20183_low_41
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 143 - 228
Target Start/End: Complemental strand, 2155189 - 2155102
Alignment:
| Q |
143 |
cctgattaaacatacccatatttgtttatctacttttagtgctgaatgaataacaaacggggca--tataaatgacatagtgtgtgga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
2155189 |
cctgattaaacatacccatatttgtttatctacttttagtgctgaatgaataataaacggggcatatataaatgacatagtgtgtgga |
2155102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University