View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_45 (Length: 239)
Name: NF20183_low_45
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 37568699 - 37568543
Alignment:
| Q |
1 |
accgtgagagttgaaaatccatgcactcctattacaccaaaattcatgctcttagtgtaaaacttgtaccaggtgtttattttcaagcttcctgcac--- |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37568699 |
accgtgagagttgaaaatccatgcactccttttacaccaaaattcatgctcttagagtaaaacttgtaccaggtgtttatt-----gcttcctgcactgc |
37568605 |
T |
 |
| Q |
98 |
----tgccaactactagcctatgcacctaaaggaaaaatgcaccatgcatttattagcaaat |
155 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37568604 |
caagtgccaactactagcctatgcacagaaaggaaaaatgcaccatgcatttattagcaaat |
37568543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 148 - 221
Target Start/End: Complemental strand, 37568518 - 37568445
Alignment:
| Q |
148 |
tagcaaatttctttggtttgacttcacccacatgcaatgcattgggtcatacacactattcaccaacaggttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37568518 |
tagcaaatttctttggtttgacttcacccacatgcaatgcattgggtcatacacactattcaccaacaggttca |
37568445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University