View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20183_low_50 (Length: 216)

Name: NF20183_low_50
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20183_low_50
NF20183_low_50
[»] scaffold0200 (1 HSPs)
scaffold0200 (17-196)||(28779-28958)


Alignment Details
Target: scaffold0200 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 28958 - 28779
Alignment:
17 caaaggcatggagaggagatgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga 116  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28958 caaaggcatggagaggagacgttcgagaaactaccggaaacggtgtaaatttcttctatgatggacaaggtttcatgtctgttcaattgactagaacaga 28859  T
117 tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatat 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28858 tgcaaacattgtgttctatgatgtttctggccaggttttgcacaaaaccacttcatcaaagcagctacattcttccatat 28779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University