View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20183_low_53 (Length: 206)
Name: NF20183_low_53
Description: NF20183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20183_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 4571123 - 4571299
Alignment:
| Q |
18 |
aatacgacataaacttttgagtatgccaccagatcttgttagacttttaaaaaatgtcataccatacattctttaaaaaagaaaatatcatagacaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4571123 |
aatacgacataaacttttgagtatgccaccagatcttgttagacttttaaaaaatgtcataccatacattctttaaaaaagaaaatatcatagacaaaca |
4571222 |
T |
 |
| Q |
118 |
atgatttaa-nnnnnnnnaagagacactattttcnnnnnnnagagtaggatattaatttaatcttgttaagaataat |
193 |
Q |
| |
|
||||||||| |||||||||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4571223 |
atgatttaatttttttttaagagacactattttctttttttagaggaggatattaatttaatcttgttaataataat |
4571299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University