View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20185_low_14 (Length: 204)

Name: NF20185_low_14
Description: NF20185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20185_low_14
NF20185_low_14
[»] chr2 (1 HSPs)
chr2 (17-155)||(6418157-6418296)


Alignment Details
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 6418296 - 6418157
Alignment:
17 acttaaaaactgcattggaannnnnnnaaaggattttgaaactattctttctttataatgctctaccnnnnnnntaaagaaaatatcacttaatactaca 116  Q
    ||||||||| ||||||||||       ||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
6418296 acttaaaaaatgcattggaatttttttaaaggattttgaaactattctttctttataatgctctaccaaaaaaataaagaaaatatcacttaatactaca 6418197  T
117 -nnnnnnngttgttgaaggaaatcacttaatctcatctca 155  Q
             |||||||||||||||||| ||||||||||||    
6418196 tttttttttttgttgaaggaaatcactcaatctcatctca 6418157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University