View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20185_low_14 (Length: 204)
Name: NF20185_low_14
Description: NF20185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20185_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 6418296 - 6418157
Alignment:
| Q |
17 |
acttaaaaactgcattggaannnnnnnaaaggattttgaaactattctttctttataatgctctaccnnnnnnntaaagaaaatatcacttaatactaca |
116 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6418296 |
acttaaaaaatgcattggaatttttttaaaggattttgaaactattctttctttataatgctctaccaaaaaaataaagaaaatatcacttaatactaca |
6418197 |
T |
 |
| Q |
117 |
-nnnnnnngttgttgaaggaaatcacttaatctcatctca |
155 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
6418196 |
tttttttttttgttgaaggaaatcactcaatctcatctca |
6418157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University