View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20186_low_23 (Length: 213)
Name: NF20186_low_23
Description: NF20186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20186_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 7949373 - 7949191
Alignment:
| Q |
15 |
gctagattagaacatctgaagcaaagcgcaactattatctgccaataggcccttggcccagtggtgagtggccctgacaaggttcttctcctgtgttcac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7949373 |
gctagattagaacatctgaagcaaagcgcaattattatctgccaataggcctttggcccagtggtgagtggccctgacaaggttcttctcctgtgttcac |
7949274 |
T |
|
| Q |
115 |
agattcaatttctacttttctaccatctctctcatagcaaagtaaagcagaacaatgatctatccgcttcaaatgtatcacat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7949273 |
agattcaatttctacttttctaccatctctctcatagcaaagtaaagcagaacaatgatctatccgcttcaaatgtatcacat |
7949191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 33001413 - 33001247
Alignment:
| Q |
23 |
agaacatctgaagcaaagcgcaactattatctgccaataggcccttggcccagtggtgagtggccctgacaaggttcttctcctgtgttcacagattcaa |
122 |
Q |
| |
|
|||||||||||||||||| |||| || |||| ||||||||| || ||||||||||||||||||||||||||||||| || |||| |||| ||||| |
|
|
| T |
33001413 |
agaacatctgaagcaaagagcaattaatatccatcaataggccttttgcccagtggtgagtggccctgacaaggttct---ccagtgtccacaagttcaa |
33001317 |
T |
|
| Q |
123 |
tttctacttttctaccatctctctcatagcaaagtaaagcagaacaatgatctatccgcttcaaatgtat |
192 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
33001316 |
tttctacttttctaccacctctctcatagcaaagcaaagcagaacaatgatctgtccgcttcaaatgtat |
33001247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University