View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_high_19 (Length: 308)
Name: NF20187_high_19
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_high_19 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0013 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 17 - 279
Target Start/End: Original strand, 39319 - 39577
Alignment:
| Q |
17 |
ccctattgatccaaatttacatagagaaatggattttgtacaatatttatcaattcaaggtgcgtcaacagaagtcccatttactgcttatttatcaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39319 |
ccctattgatccaaatttacatagagaaatggatcttgtacagtatttatcgattcaaggtgcgtcaacagaagtcccatttactacttatttatcaaag |
39418 |
T |
|
| Q |
117 |
agtnnnnnnnnnnnnnncaattacaaaggcatatcaaacccgctctcaaggtcccccgcctgcacctaatgaagannnnnnnctggaatttcaagggtat |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39419 |
agtaaaaaaaaaa----caattacaaaggcatatcaaacccgctctcaaggtccccctcctgcacctaatgaagatttttttctggaatttcaagggtat |
39514 |
T |
|
| Q |
217 |
agcttacgaaagtatgtatgaataatagagaccctttcatgcctaatctctgggcattatggg |
279 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39515 |
agcttacgaaattatgtatgaataatagagaccctttcatgcctaatctctgggcattatggg |
39577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 203 - 267
Target Start/End: Complemental strand, 29478977 - 29478913
Alignment:
| Q |
203 |
aatttcaagggtatagcttacgaaagtatgtatgaataatagagaccctttcatgcctaatctct |
267 |
Q |
| |
|
|||||||||||||||| |||| ||| | ||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
29478977 |
aatttcaagggtataggttacaaaattttgtatgaataataaagaccctttaaagcctaatctct |
29478913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 233 - 279
Target Start/End: Original strand, 24575538 - 24575584
Alignment:
| Q |
233 |
tatgaataatagagaccctttcatgcctaatctctgggcattatggg |
279 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||| |||||| |
|
|
| T |
24575538 |
tatgaacaatagagaccctttaatgcctaatctttgggcactatggg |
24575584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University