View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_high_22 (Length: 283)
Name: NF20187_high_22
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 4095708 - 4095774
Alignment:
| Q |
72 |
aattaggtcaccatcttagacataatgacgagtaggaccgtaaacttgtactttagaggaacatttat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4095708 |
aattaggtcaccatcttagacataatgacgagtagga-cgtaaacttgtactttagaggaacatttat |
4095774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 4095585 - 4095652
Alignment:
| Q |
1 |
tgtccttgtagctgggatggtgacttgatgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095585 |
tgtccttgtagctgggatggtgacttgat---cggtaccagttcaataaaagcaaggaaaaatgaatatgt |
4095652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University