View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20187_high_22 (Length: 283)

Name: NF20187_high_22
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20187_high_22
NF20187_high_22
[»] chr4 (2 HSPs)
chr4 (72-139)||(4095708-4095774)
chr4 (1-71)||(4095585-4095652)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 72 - 139
Target Start/End: Original strand, 4095708 - 4095774
Alignment:
72 aattaggtcaccatcttagacataatgacgagtaggaccgtaaacttgtactttagaggaacatttat 139  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
4095708 aattaggtcaccatcttagacataatgacgagtagga-cgtaaacttgtactttagaggaacatttat 4095774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 4095585 - 4095652
Alignment:
1 tgtccttgtagctgggatggtgacttgatgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt 71  Q
    |||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||    
4095585 tgtccttgtagctgggatggtgacttgat---cggtaccagttcaataaaagcaaggaaaaatgaatatgt 4095652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University