View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_high_24 (Length: 281)
Name: NF20187_high_24
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 268
Target Start/End: Complemental strand, 4997208 - 4996960
Alignment:
| Q |
20 |
cagggtagcatggaatgtgaggaaatagcattaccaagaaaattggtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997208 |
cagggtagcatggaatgtgaggaaatagcattaccaagaaaattcgtagcaagtgaaagattttggagtgttggaatatgacagaaattagatggaaaat |
4997109 |
T |
 |
| Q |
120 |
caccataaataccggtttctgtgaggtcgattgatacaacggatttattccacgaatcgcaggttatgcctctccagttacaaggattatgatctgtgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997108 |
caccataaataccggtttctgtgaggtcgattgatacaacggatttattccgcgaatcgcaggttatgcctctccagttacaaggattatgatctgtgtt |
4997009 |
T |
 |
| Q |
220 |
tggaagccaatcattgagacttttgtttttgtcatcaatttgtgtgttc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4997008 |
tggaagccaatcattgagacttttgtttttgtcatcaatttgtgtgttc |
4996960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University