View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_high_26 (Length: 267)
Name: NF20187_high_26
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 164 - 249
Target Start/End: Complemental strand, 27006701 - 27006616
Alignment:
| Q |
164 |
taatagctcacaagtcagagggaaactcactgactctagcaaggccaattattttgaatgttgacattgacatccatagatttgtg |
249 |
Q |
| |
|
|||||| ||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
27006701 |
taataggtcaaaaatcagagggaaactcactgactctagcaaggccaattatgttgaatgttgacattgccatccatagatttgtg |
27006616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 37581978 - 37581919
Alignment:
| Q |
30 |
atccatgacagaataactgtgaaaattgtaaaggctatcgaattaagatttagctgtatg |
89 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37581978 |
atccatgacggaataactgtgaaaattgtaaaggctatcgaattaagatttagctatatg |
37581919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 171 - 250
Target Start/End: Complemental strand, 37581839 - 37581762
Alignment:
| Q |
171 |
tcacaagtcagagggaaactcactgactctagcaaggccaattattttgaatgttgacattgacatccatagatttgtgt |
250 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
37581839 |
tcactagtcagagggaaactca--gactctagcaaggccaattatgttgaatgcagacattgtcatccatagatttgtgt |
37581762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 128 - 165
Target Start/End: Complemental strand, 37581914 - 37581877
Alignment:
| Q |
128 |
ttttttaagcaaggcttatttaaaatatggatgaccta |
165 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37581914 |
ttttttaagcaacgcttatttaaaatatggatgaccta |
37581877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University