View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_high_30 (Length: 241)
Name: NF20187_high_30
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 3 - 233
Target Start/End: Original strand, 11897093 - 11897322
Alignment:
| Q |
3 |
cttctttgagttttgacattatttctggtgcaaaccttcttggtaactgcttcactggatttttgtctagtcgaattggcaacttccattccatcatttc |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
11897093 |
cttctttgatttttgacattatttctggtgcaaactttcttgataactgcttcactggatttttgtctggtcgaattggcaacttccattccaccatttc |
11897192 |
T |
 |
| Q |
103 |
tctattcgatcatggcatctcattgtaatcccaaacaaaagcaatttttgaactcttttaaaagttcaattgtttgtccctttaaatttgaatcaattat |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11897193 |
tctattcaatcatggcatctcattgtaatcccaaac-aaagcaatctttgaactcttttaaaagttcaattgtttgtacctttaaatttgaatcaattat |
11897291 |
T |
 |
| Q |
203 |
gaagcttatatatgttggcctcttctctgct |
233 |
Q |
| |
|
| | ||||||||||||||||||||| ||||| |
|
|
| T |
11897292 |
ggaacttatatatgttggcctcttcactgct |
11897322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University