View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_low_22 (Length: 302)
Name: NF20187_low_22
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 82 - 292
Target Start/End: Complemental strand, 9796591 - 9796381
Alignment:
| Q |
82 |
aggggtgattagattggatttgatgaattatgtaatgggacaagaatggcaccagggaattgttgcagctctgaggtagcagctacattaagtgtgtgtt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796591 |
aggggtgattagattggatttgatgaattatgtaatgggacaagaatggcaccagggaattgttgcagctctgaggtagcagctacattaagtgtgtgtt |
9796492 |
T |
 |
| Q |
182 |
ccatcatggaagatcaaaatgatgataccttggggagtttgaatcagaatgttgttgggaagcctccaagggatcattctgccactatgcgtcattgcag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796491 |
ccatcatggaagatcaaaatgatgataccttggggagtttgaatcagaatgttgttgggaagcctccaagggatcattctgccactatgcgtcattgcag |
9796392 |
T |
 |
| Q |
282 |
cagctcttcat |
292 |
Q |
| |
|
||||||||||| |
|
|
| T |
9796391 |
cagctcttcat |
9796381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University