View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_low_30 (Length: 254)
Name: NF20187_low_30
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 26265624 - 26265400
Alignment:
| Q |
14 |
cacagacacggcatcgacaccgatatcaatttgaaaaattgtatgtaacacatgtactggtgttgaacaccatacacgcccataatttgaagtgtcactg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26265624 |
cacagacacggcatcgacaccgatatcaatttgaaaaattgtatgtaacacatgtactggtgttgaacaccatacacacccataatttgaagtgtcactg |
26265525 |
T |
 |
| Q |
114 |
ctacatatgaaggctctaaattacggttgcttatgttgtgattcttgatattgggataaagttcggtctaacacgatcgatgtgtctgcaattgcagttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26265524 |
ctacatatgaaggctctaaattacggttgcttatgttgtgattcttgatattgggataaagttcggtctaacacgatcgatgtgtctgcaattgcagttg |
26265425 |
T |
 |
| Q |
214 |
tggaggcctgcaaaacctataaatt |
238 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
26265424 |
tggaagcctgcaaaacctataaatt |
26265400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 138 - 211
Target Start/End: Original strand, 31837568 - 31837641
Alignment:
| Q |
138 |
ggttgcttatgttgtgattcttgatattgggataaagttcggtctaacacgatcgatgtgtctgcaattgcagt |
211 |
Q |
| |
|
||||| || |||||||||||||||||| | || |||| ||||| || ||||||||||| ||||||||||||| |
|
|
| T |
31837568 |
ggttgattttgttgtgattcttgatatcgtgaaaaagcacggtcaaatgcgatcgatgtggctgcaattgcagt |
31837641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University